<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>bcr1340</ui>
	<ji>BCJ</ji>
	<fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>The progestational and androgenic properties of medroxyprogesterone acetate: gene regulatory overlap with dihydrotestosterone in breast cancer cells</p>
			</title>
			<aug>
				<au id="A1" ca="yes">
					<snm>Ghatge</snm>
					<mi>P</mi>
					<fnm>Radhika</fnm>
					<insr iid="I1"/>
					<email>ghatgr01@med.nyu.edu</email>
				</au>
				<au id="A2">
					<snm>Jacobsen</snm>
					<mi>M</mi>
					<fnm>Britta</fnm>
					<insr iid="I1"/>
					<email>britta.jacobsen@uchsc.edu</email>
				</au>
				<au id="A3">
					<snm>Schittone</snm>
					<mi>A</mi>
					<fnm>Stephanie</fnm>
					<insr iid="I1"/>
					<email>stephanie.schittone@uchsc.edu</email>
				</au>
				<au id="A4">
					<snm>Horwitz</snm>
					<mi>B</mi>
					<fnm>Kathryn</fnm>
					<insr iid="I1"/>
					<email>kate.horwitz@uchsc.edu</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>University of Colorado Health Sciences Center, Department of Medicine, Division of Endocrinology, Metabolism and Diabetes, Denver, Colorado, USA</p>
				</ins>
			</insg>
			<source>Breast Cancer Research</source>
			<issn>1465-5411</issn>
			<pubdate>2005</pubdate>
			<volume>7</volume>
			<issue>6</issue>
			<fpage>R1036</fpage>
			<lpage>R1050</lpage>
			<url>http://breast-cancer-research.com/content/7/6/R1036</url>
			<xrefbib>
				<pubidlist><pubid idtype="pmpid">16457685</pubid><pubid idtype="doi">10.1186/bcr1340</pubid>
				</pubidlist></xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>1</day>
					<month>6</month>
					<year>2005</year>
				</date>
			</rec>
			<revreq>
				<date>
					<day>28</day>
					<month>7</month>
					<year>2005</year>
				</date>
			</revreq>
			<revrec>
				<date>
					<day>14</day>
					<month>9</month>
					<year>2005</year>
				</date>
			</revrec>
			<acc>
				<date>
					<day>29</day>
					<month>9</month>
					<year>2005</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>2</day>
					<month>11</month>
					<year>2005</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2005</year>
			<collab>Ghatge et al.; licensee BioMed Central Ltd.</collab>
			<note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
		</cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Introduction</p>
					</st>
					<p>Medroxyprogesterone acetate (MPA), the major progestin used for oral contraception and hormone replacement therapy, has been implicated in increased breast cancer risk. Is this risk due to its progestational or androgenic properties? To address this, we assessed the transcriptional effects of MPA as compared with those of progesterone and dihydrotestosterone (DHT) in human breast cancer cells.</p>
				</sec>
				<sec>
					<st>
						<p>Method</p>
					</st>
					<p>A new progesterone receptor-negative, androgen receptor-positive human breast cancer cell line, designated Y-AR, was engineered and characterized. Transcription assays using a synthetic promoter/reporter construct, as well as endogenous gene expression profiling comparing progesterone, MPA and DHT, were performed in cells either lacking or containing progesterone receptor and/or androgen receptor.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st>
					<p>In progesterone receptor-positive cells, MPA was found to be an effective progestin through both progesterone receptor isoforms in transient transcription assays. Interestingly, DHT signaled through progesterone receptor type B. Expression profiling of endogenous progesterone receptor-regulated genes comparing progesterone and MPA suggested that although MPA may be a somewhat more potent progestin than progesterone, it is qualitatively similar to progesterone. To address effects of MPA through androgen receptor, expression profiling was performed comparing progesterone, MPA and DHT using Y-AR cells. These studies showed extensive gene regulatory overlap between DHT and MPA through androgen receptor and none with progesterone. Interestingly, there was no difference between pharmacological MPA and physiological MPA, suggesting that high-dose therapeutic MPA may be superfluous.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusion</p>
					</st>
					<p>Our comparison of the gene regulatory profiles of MPA and progesterone suggests that, for physiologic hormone replacement therapy, the actions of MPA do not mimic those of endogenous progesterone alone. Clinically, the complex pharmacology of MPA not only influences its side-effect profile; but it is also possible that the increased breast cancer risk and/or the therapeutic efficacy of MPA in cancer treatment is in part mediated by androgen receptor.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Introduction</p>
			</st>
			<p>Synthetic progestins have been in use since the 1950s. Today more than 15 million women use them either in combination oral contraceptives or for hormone replacement therapy (HRT) <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Although progestins are added to estrogens because they significantly lower the risk for endometrial cancer, HRT is often not started or discontinued prematurely because of breast cancer fears. Recent data from the Women's Health Initiative <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp> suggest slight increases in relative risk (RR) for developing invasive breast cancer (RR 1.26), cardiovascular disease (RR 1.22), pulmonary emboli (RR 2.13), and dementia (RR 2.05) in women on HRT containing continuous dosing of conjugated equine estrogen and medroxyprogesterone acetate (MPA). This led to premature termination of the estrogen + MPA arm of the trial. The estrogen-only arm was recently terminated and its analysis, although indicating an increased risk for stroke (hazard ratio 1.39), showed no increase in breast cancer risk (hazard ratio 0.77) <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. These and other data <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> implicate the progestin component in the increased breast cancer risk observed with estrogen + MPA <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>.</p>
			<p>Most synthetic progestins are derived from either testosterone or 17&#945;-hydroxyprogesterone (Fig. <figr fid="F1">1</figr>). MPA (Depo-Provera UpJohn, St Louis, MO and Provera UpJohn, St Louis, MO) is a 17&#945;-hydroxyprogesterone derivative and is the most common HRT progestin in use in the USA <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. It is used in place of progesterone because of its longer half-life <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Synthetic progestins in general were originally selected based on the similarity of their pharmacology to that of progesterone <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. However, although modern molecular information is available about the genes regulated by progesterone <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>, there are no global data on the genes regulated by synthetic progestins. Recently, Nilsen and Brinton <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> reported differences between the abilities of MPA and progesterone to activate mitogen-activated protein kinase signaling in hippocampal neurons. Progesterone and MPA also differ in their ability to express vascular cell adhesion molecule-1 in human vascular endothelial cells <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Furthermore, in addition to their progestational effects, and unlike natural progesterone, synthetic progestins often bind other steroid receptors including those for androgens (androgen receptors [AR]) and glucocorticoids (glucocorticoid receptors [GR]) <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Thus, depending on the dose and tissue, it is possible that synthetic progestins differ in their gene regulatory profile compared with progesterone.</p>
			<fig id="F1">
				<title>
					<p>Figure 1</p>
				</title>
				<caption>
					<p>Chemical structures of progesterone, MPA, R5020 and DHT</p>
				</caption>
				<text>
					<p>Chemical structures of progesterone, MPA, R5020 and DHT. The pharmaceutical name and manufacturer are shown italic text. DHT, dihydrotestosterone; MPA, medroxyprogesterone acetate.</p>
				</text>
				<graphic file="bcr1340-1" hint_layout="double"/>
			</fig>
			<p>Progestins signal mainly though progesterone receptors (PR), which are members of the steroid receptor family of nuclear receptors. There are two naturally occurring human PR isoforms, PR-A and PR-B <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>, which are identical except for 164 additional amino acids at the amino-terminus of PR-B. For this reason, the two PR vary in their ability to activate transcription on exogenous <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp> and endogenous promoters, with PR-B being 10 times more active than PR-A <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B19">19</abbr></abbrgrp>. Ratios of PR-A to PR-B ratios vary in different tissues, physiological states, and breast cancers <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. The normal human breast contains equimolar amounts of PR-A and PR-B, but ratios of PR-A to PR-B are dysregulated in more than 70% of advanced breast cancers <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Excess PR-A levels correlate with poorer disease-free survival and more rapid relapse following tamoxifen treatment <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Ligand binding leads to PR activation, dimerization, and binding of dimers to promoters at progesterone responsive elements (PREs), followed by interaction with coregulators and altered transcription <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. PREs are also consensus binding sites for other nuclear receptors, including AR and GR <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. In additional, given the 60% similarity in the ligand binding domains between AR and PR, some ligands &#8211; including MPA &#8211; can bind both steroid receptors <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>.</p>
			<p><it>In vivo</it>, progesterone and most natural steroid hormones are actively metabolized in the liver <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. In breast cancer cells <it>in vitro</it>, progesterone at physiologic concentrations (10&#8211;20 nmol/l) is sufficient to activate all receptors <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. Physiologic concentrations of progesterone have a half-life of 2&#8211;4 hours in cells, and even at pharmacologic concentrations (1 &#956;mol/l) progesterone is still entirely metabolized within 18 hours to its final metabolic product, namely 5&#945;-pregnan-3&#946;, 6&#945;-diol-20-one it's correct<abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. In contrast, under the same <it>in vitro </it>conditions synthetic progestins, including MPA, megestrol acetate, R5020, and the antiprogestin RU486, are not metabolized at all <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>, and 20&#8211;40% of dihydrotestosterone (DHT) remains unmetabolized at 18 hours <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Specifically with regard to MPA, the active form is the parent compound MPA itself <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Serum levels of MPA needed for contraceptive efficacy are about 2 nmol/l (1 ng/ml) <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> and for HRT the range is 0.02&#8211;0.2 nmol/l (0.01&#8211;0.1 ng/ml); these levels are considered to be 'physiologic'. In addition to its use in contraception and HRT, MPA is also commonly used to treat endometrial cancer and as a second line agent to treat breast cancer <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>; for these indications its serum levels are approximately 0.14&#8211;1.7 &#956;mol/l (55&#8211;650 ng/ml) <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>, which are 'pharmacologic' concentrations. Thus, depending on need, there is a wide range of concentrations at which MPA is used clinically. MPA also has known glucocorticoid <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp> and androgenic <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr></abbrgrp> activities in breast cancer cells. It exhibits moderate relative binding affinity (58%) to GR and a slightly slower relative binding affinity to AR (36%) <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>.</p>
			<p>The goal of the present study was to evaluate the transcriptional similarities and differences between physiologic and pharmacologic progesterone and MPA concentrations, focusing on the abilities of these hormones to signal through PR, AR, and GR. Under the conditions tested, we found that &#8211; in addition to its progestational actions &#8211; MPA is an active androgen. We therefore defined global gene regulatory patterns of MPA on PR and AR and showed that at physiologic concentrations and early time points MPA is a dual function hormone. Like progesterone, it is a good progestin; unlike progesterone, it is also a strong androgen in breast cancer cells. These findings may have important clinical implications for physicians counseling women regarding the use of MPA in HRT.</p>
		</sec>
		<sec>
			<st>
				<p>Materials and methods</p>
			</st>
			<sec>
				<st>
					<p>Cell lines and culture</p>
				</st>
				<p>The T47Dco breast cancer cell line (PR-A<sup>+ </sup>and PR-B<sup>+</sup>), its PR-negative T47D-Y subline, and construction of T47D-YB (PR-B<sup>+</sup>) and T47D-YA (PR-A<sup>+</sup>) cell lines were previously described <abbrgrp><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr></abbrgrp>. Construction of HeLa cervical carcinoma cells stably expressing flag tagged PR-A (HeLa-A) or PR-B (HeLa-B) were also previously described <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. To construct Y-AR cells, PR-negative T47D-Y cells were electroporated with a G418 resistance plasmid along with the pCMV5-AR vector containing the complete sequence for human AR <abbrgrp><abbr bid="B48">48</abbr></abbrgrp> (a kind gift from E Wilson). Colonies were picked and maintained under G418 selection. Transient transfection with a PRE<sub>2</sub>/luciferase reporter <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> and western blotting for AR were used to screen 19 clones, using T47D-Y cells transiently transfected with both AR and the reporter as a positive control. For this, cells were treated with ethanol or 1 &#956;mol/l DHT and harvested at 20 hours, and relative luciferase activity was assessed. Three positive clones were identified, and clone 17 (renamed Y-AR) was used for further experiments. Cells were routinely passaged in minimum essential medium with Earle's salts containing L-glutamine (292 &#956;g/l) buffered with sodium bicarbonate (2.2 &#956;g/l), insulin (6 ng/ml), and 7.5% fetal calf serum. Cells stably expressing receptors &#8211; YB, Y-AR, HeLa-A and HeLa-B &#8211; were also cultured in 200 &#956;g/ml G418.</p>
			</sec>
			<sec>
				<st>
					<p>Transcription assays</p>
				</st>
				<p>Progesterone and MPA were obtained from Sigma (St Louis, MO, USA) and DHT was a gift from M Wierman (Veterans Affairs Medical Center, Denver, CO, USA). Cells were placed in minimum essential medium containing 5% twice dextran-coated charcoal (DCC) stripped serum for 24 hours. They were then transfected by electroporation at 220 V and 950 &#956;F with the PRE<sub>2</sub>/TATA-luciferase reporter along with CMV/Renilla as an internal control, and with PR-B, PR-A, or AR expression vectors as appropriate. Cells were plated at a density of 10<sup>6 </sup>cells/35 mm dish and treated with increasing concentrations of hormones in triplicate. The cells were harvested 20 hours later, lysed in 1&#215; lysis buffer (Promega, San Diego, CA, USA) and luciferase and Renilla activity (Promega, Madison, WI, USA) were measured. Prism v3.0 (GraphPad Software, San Diego, CA, USA) was used for all data analysis. Statistical analysis was performed using the Student's t-test. Error bars reflect the standard error of the mean. HeLa wild-type, HeLa-A, and HeLa-B cells were plated in 60 mm dishes at 120,000 cells/dish in 3 ml of 5% twice DCC-stripped serum containing medium. HeLa cells stably expressing PR-A or PR-B were transfected with the PRE<sub>2</sub>/TATA-luciferase (1 &#956;g/dish) and SV40/Renilla (10 ng/dish) constructs using CaPO<sub>4</sub>. After overnight incubation at 37&#176;C, precipitate was washed out and cells were treated with 0.01 nmol/l to 1 &#956;mol/l R5020, MPA, or DHT dissolved in ethanol. Cells were harvested at 20 hours, lysed in 1&#215; lysis buffer, and luciferase and Renilla activity measured. Wild-type HeLa cells were also transfected with an AR expression vector (50 ng/dish) as appropriate.</p>
			</sec>
			<sec>
				<st>
					<p>Expression profiling</p>
				</st>
				<p>T47Dco, Y, and Y-AR cells in log phase were placed in 5% twice DCC-stripped serum containing medium for 24 hours and then treated with vehicle, or 10 nmol/l progesterone or MPA for 6 hours. Y-AR cells were additionally treated with 1 &#956;mol/l MPA and 10 nmol/l DHT. Experiments were done in triplicate for each cell line and treatment group using time separated samples. AR and/or PR protein levels were monitored by immunoblotting. Cells were harvested and washed, and total RNA was isolated using Rneasy Midi Kit (Qiagen, Valencia, CA, USA). RNA integrity was confirmed using an Agilent Bioanalyzer (Agilent, Palo Alto, CA, USA). RNA was prepared according to the Affymetrix Expression Analysis Technical Manual (Affymetrix, Inc., Santa Clara, CA, USA). Briefly, first and second strand cDNA synthesis was performed followed by clean up of double-stranded cDNA. Antisense cRNA was biotin labeled for 4 hours in an <it>in vitro </it>transcription reaction, and 20 &#956;g biotin-labeled cRNA was fragmented and hybridized. Microarray analysis was performed using Affymetrix gene chips (HuFL-U133 plus2). Data were analyzed using Gene Spring version 6.0 (Silicon Genetics, San Carlos, CA, USA) and GCOS (Affymetrix, Inc.). Each treatment group was compared with ethanol treatment. Low-dose and high-dose MPA treatments were additionally compared with each other. Statistical significance (<it>P </it>&lt; 0.05) for a 2.0-fold change was assessed by one-way analysis of variance. Dendrograms were generated in Gene Spring version 6.0 (Silicon Genetics) using hierarchical clustering, and similarity was measured using a distance correlation <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>Androgen receptor immunoblotting</p>
				</st>
				<p>Whole cell extracts were prepared in radioimmune precipitation buffer with protease inhibitors, as described previously <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. Extracts were resolved on a 7.5% denaturing polyacrylamide gel, transferred to nitrocellulose, and blocked and probed for AR with a 1:3000 dilution of AR antibody (PG-21; Upstate Biotechnology, Lake Placid, NY, USA). Following incubation with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody, protein bands were visualized by enhanced chemiluminescence (Amersham Biosciences Pharmacia Biotech, Arlington Heights, IL).</p>
			</sec>
			<sec>
				<st>
					<p>Immunocytochemistry/confocal microscopy</p>
				</st>
				<p>Sterile coverslips were placed into 35 mm dishes along with Y-AR cells at a density of 60,000 cells/35 mm dish in 5% twice DCC-stripped serum overnight. Cells were treated with ethanol or 1 &#956;mol/l DHT for 30 min, 2 hours and 20 hours, and fixed in a 70% methanol/30% acetone mixture for 5 min. Coverslips were rinsed in phosphate-buffered saline (PBS), blocked in 10% normal goat serum/PBS for 1 hour at room temperature, and washed twice in PBS. Coverslips were probed with PG-21 diluted to 0.5 &#956;g/ml in 1% normal goat serum/PBS for 2 hours at 25&#176;C. Cells were washed twice with PBS for 5 min and incubated with a 1:1500 dilution of goat anti-rabbit IgG flourescein-conjugated secondary antibody for 2 hours and then washed. The primary antibody was omitted to control for nonspecific staining. Cells were incubated with 1 ml of a 1:1000 dilution of DAPI in methanol for 15 min at 37&#176;C for nuclear staining. Coverslips were mounted with 50 &#956;l Fluoromount G (Electron Microscopy Sciences, Hatfield, PA, USA). Cells were visualized using an Olympus IX70 inverted microscope and a Photometrics Quantix camera at 100&#215; magnification. Images were deconvolved using a Silicon Graphics O2 computer with DeltaVision software. Representative z stack images are shown.</p>
			</sec>
			<sec>
				<st>
					<p>Reverse transcription polymerase chain reaction</p>
				</st>
				<p>Regulation of several genes was confirmed by RT-PCR. Y and Y-AR cells were placed in 5% twice DCC-stripped serum overnight, treated with appropriate doses of EtOH, R5020, progesterone, MPA and DHT for 6 or 12 hours, and harvested for RNA (Rneasy Midi Kit, Qiagen). cDNA was synthesized from independent total RNA <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Samples were resolved on 2% agarose gels and stained with ethidium bromide. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was run as an internal control <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Primer sets are as described in Table <tblr tid="T1">1</tblr>.</p>
				<tbl id="T1" hint_layout="double">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>RT-PCR primer sets</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="left">
								<p>Gene ID</p>
							</c>
							<c ca="left">
								<p>Forward primer</p>
							</c>
							<c ca="left">
								<p>Reverse primer</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>KLK3 [72] (GenBank: <ext-link ext-link-type="gen" ext-link-id="NM_001468">NM_001468</ext-link>)</p>
							</c>
							<c ca="left">
								<p>TGCGCAAGTTCACCCTCA</p>
							</c>
							<c ca="left">
								<p>CCCTCTCCTTACTTCATCC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Krt4 (GenBank <ext-link ext-link-type="gen" ext-link-id="X07695">X07695</ext-link>)</p>
							</c>
							<c ca="left">
								<p>GTAGCTACTTCTTGATTTGGGCCTG</p>
							</c>
							<c ca="left">
								<p>ATAATACAGGATCTAGTGGGAGATG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>CDKN1C (GenBank: <ext-link ext-link-type="gen" ext-link-id="NM_000076">NM_000076</ext-link>)</p>
							</c>
							<c ca="left">
								<p>TGAGAAGTCGTCGGGCGATGTCCCC</p>
							</c>
							<c ca="left">
								<p>GCCGGTTGCTGCTACATGAACGGTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MAFB (GenBank: <ext-link ext-link-type="gen" ext-link-id="NM_005461">NM_005461</ext-link>)</p>
							</c>
							<c ca="left">
								<p>TCAAGTGCGTTCTTTAGACCAATGC</p>
							</c>
							<c ca="left">
								<p>CTGATGCAGGACAAATATCCACAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>F3 (GenBank: <ext-link ext-link-type="gen" ext-link-id="NM_001993">NM_001993</ext-link>)</p>
							</c>
							<c ca="left">
								<p>CACAGAGTGTGACCTCACCGACGAG</p>
							</c>
							<c ca="left">
								<p>GTACTCTTCCGGTTAACTGTTCGG</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Results</p>
			</st>
			<sec>
				<st>
					<p>Synthetic progestins and progesterone receptor</p>
				</st>
				<p>Historically, synthetic progestins were developed based on the similarity of their biologic actions to those of progesterone <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Figure <figr fid="F1">1</figr> shows the chemical structure of progesterone and those of its steroidal 17&#945;-hydroxyprogesterone derivatives MPA and R5020, which are used clinically and experimentally, respectively. Also shown is the structure of the androgen DHT <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
				<p>The transcriptional activity of metabolizable progesterone, when given every 6 hours, is identical to that of 24 hours of nonmetabolizable R5020 (not shown). We therefore initially used 24 hours of R5020 as the standard against which to compare 24 hours of MPA for <it>in vitro </it>transcription assays. Wild-type T47Dco breast cancer cells endogenously expressing PR-A and PR-B were transfected with a PRE<sub>2</sub>/luciferase construct and treated with increasing concentrations of R5020, MPA, or DHT. Figure <figr fid="F2">2a</figr> shows approximately equivalent transcriptional activities by R5020 and MPA at all except the 1000 nmol/l dose. DHT had little activity on PR except at the 1000 nmol/l dose.</p>
				<fig id="F2">
					<title>
						<p>Figure 2</p>
					</title>
					<caption>
						<p>Transcriptional activities of MPA, R5020 and DHT under the control of PR and PR isoforms</p>
					</caption>
					<text>
						<p>Transcriptional activities of MPA, R5020 and DHT under the control of PR and PR isoforms. <b>(a) </b>T47Dco breast cancer cells with wild-type equimolar levels of PR-A and PR-B. T47Dco cells were transfected with PRE<sub>2</sub>/luciferase and a Renilla luciferase internal control. Cells were treated for 20 hours with MPA, R5020, or DHT, at concentrations ranging from 0.01 to 1000 nmol/l. Luciferase activity was quantitated as a percentage of 1 &#956;mol/l R5020 activity. The study was performed in triplicate and data are reported as mean &#177; standard error. *<it>P </it>&lt; 0.05, 1 &#956;mol/l dose of hormone versus 1 &#956;mol/l R5020. <b>(b) </b>HeLa cervicocarcinoma cells stably expressing PR-A. <b>(c) </b>PR-negative T47D-Y breast cancer cells transiently transfected with PR-A. <b>(d) </b>HeLa cells stably expressing PR-B. <b>(e) </b>T47D-Y cells stably expressing PR-B. Transient transfection and transcription studies were performed as described above for panel a. DHT, dihydrotestosterone; MPA, medroxyprogesterone acetate; PR, progesterone receptor.</p>
					</text>
					<graphic file="bcr1340-2" hint_layout="double"/>
				</fig>
				<p>Although wild-type HeLa cervical cancer cells are both PR and AR negative, T47D-Y (PR-negative) cells did express low levels of endogenous AR by western blot. However, the AR were not functional, based on transcription assays with MPA or DHT, and by RT-PCR transcript expression of the androgen-responsive prostate-specific antigen (PSA) gene (not shown). We next addressed the contribution of each PR isoform individually in HeLa cervical and T47D-Y breast cancer cells exogenously expressing PR-A or PR-B, cotransfected with PRE<sub>2</sub>/luciferase, and treated with increasing concentrations of R5020, MPA, or DHT (Fig <figr fid="F2">2b&#8211;e</figr>). Because of differing transfection efficiencies of Y cells transiently transfected with PR-A and YB cells, a comparison of luciferase activities could only be made between hormone treatments in the same cell line. A mock transfected control vector exhibited no activity upon addition of vehicle or hormone (not shown). On PR-A in HeLa cells, MPA had equivalent activity to R5020 at physiologic doses but higher activity at pharmacologic doses. DHT had little to no activity on PR-A. On PR-B in HeLa cells, MPA had transcriptional activity equivalent to or lower than that of R5020 at all doses. DHT was active at the 1000 nmol/l dose. In T47D-Y cells, MPA had lower transcriptional activity at all doses through both PR-A and PR-B, at least on this synthetic promoter. DHT exhibited no transcriptional activity through PR-A but had some activity through PR-B.</p>
			</sec>
			<sec>
				<st>
					<p>Expression profiling of acute progesterone versus medroxyprogesterone acetate in progesterone receptor-positive breast cancer cells</p>
				</st>
				<p>To evaluate in detail the differences, if any, between physiologic concentrations of progesterone and MPA, we used expression profiling (Fig. <figr fid="F3">3a</figr>) at a sufficiently early time point to assess direct transcriptional effects of the hormones <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> while avoiding problems of progesterone metabolism <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Wild-type T47Dco breast cancer cells containing equimolar levels of PR-A and PR-B <abbrgrp><abbr bid="B46">46</abbr></abbrgrp> were treated with 10 nmol/l progesterone or MPA for 6 hours. T47D-Y, a PR-negative T47Dco subline, served as the control. RNA from triplicate, time-separated data points was used for analysis of gene chips interrogating about 47,000 human transcripts. Statistically significant 2.0-fold regulation was chosen as the cutoff. Venn diagrams presented in Fig. <figr fid="F3">3a</figr> summarize the results.</p>
				<fig id="F3">
					<title>
						<p>Figure 3</p>
					</title>
					<caption>
						<p>Expression profiles of endogenous PR-regulated genes</p>
					</caption>
					<text>
						<p>Expression profiles of endogenous PR-regulated genes. Shown are expression profiles of PR-regulated endogenous genes in breast cancer cell lines, with physiological progesterone versus MPA concentrations compared. <b>(a) </b>Venn diagrams showing gene number per condition. PR-positive T47Dco cells (CO) and control PR-negative T47D-Y (Y) cells were treated with 10 nmol/l progesterone or MPA for 6 hours in triplicate, time-separated experiments. Microarray analysis using Affymetrix U-133 2 plus gene chips, displaying about 47,000 genes, was performed. Data were analyzed using Gene Spring software and statistical analysis was conducted using a one-way analysis of variance, with <it>P </it>&lt; 0.05 considered statistically significant for genes regulated at least 2.0-fold. Detailed tables showing complete gene lists are available as Additional files <supplr sid="S1">1</supplr> and <supplr sid="S2">2</supplr>. <b>(b) </b>Dendrograms of PR-regulated genes showing relationships among treatment groups. Gene Spring 6.0 was used to classify all genes 'present' and all MPA- and progesterone-regulated genes. On the left is shown the relatedness among groups for all genes. On the right is a heat map of progestin regulated genes: black = average expression; red = above average; and green = below average. Each column represents a single gene; each row is a cell type and treatment group. DHT, dihydrotestosterone; MPA, medroxyprogesterone acetate; PR, progesterone receptor.</p>
					</text>
					<graphic file="bcr1340-3" hint_layout="double"/>
				</fig>
				<p>Using a 2.0-fold cutoff, in T47Dco cells a total of 1096 (2.3%) transcripts were found to be regulated by one or both hormones. Of these, 49% were upregulated and 51% were downregulated. Among upregulated genes, 329 (61%) were controlled by both progesterone and MPA, with the extent of regulation ranging between about 38-fold and 2.0-fold. Similarly, among downregulated genes 257 (46%) were controlled by both hormones, with the extent of regulation ranging from about 14-fold to 2.0-fold. When the 2.0-fold restriction was slightly relaxed, the extent of overlap between progesterone and MPA was even greater. For example, of the 120 genes regulated 2.0-fold by MPA, 60 genes were also regulated by progesterone if a 1.5-fold cutoff was allowed.</p>
				<p>In summary, we found remarkable congruence in genes regulated by progesterone and MPA. Detailed gene lists are available in <supplr sid="S1">Additional file 1</supplr>. These tables demonstrate that both the gene expression profiles and extent of regulation were similar between the hormones. The few genes regulated uniquely by either progesterone or MPA (Fig. <figr fid="F3">3a</figr>) were regulated at much lower levels. Note also that PR-negative T47D-Y cells were included as controls and exhibited very little progestin regulation, as was expected. We speculate that the few genes that appear to be regulated do so via a membrane receptor <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>.</p>
				<suppl id="S1">
					<title>
						<p>Additional File 1</p>
					</title>
					<text>
						<p>Excel files containing tables showing the genes regulated by progesterone and MPA in T47D breast cancer cells: A, MPA upregulated; B, progesterone upregulated; C, MPA downregulated; D, progesterone downregulated; E, upregulated by both progesterone and MPA; F, downregulated by both progesterone and MPA.</p>
					</text>
					<file name="bcr1340-S1.zip">
						<p>Click here for file</p>
					</file>
				</suppl>
				<p>The dendrogram presented in Fig. <figr fid="F3">3b</figr>, assembled from the sum of all MPA + progesterone regulated genes demonstrates graphically the remarkable similarity between the two hormones, which segregate PR-positive, hormone-treated cells into a different branch from PR-positive, untreated cells. Also of interest is the fact that hormone treatment has little effect in the absence of PR <abbrgrp><abbr bid="B51">51</abbr></abbrgrp> and that PR positivity, even in the absence of hormone, alters cells sufficiently to segregate them into a different branch of the dendrogram. This unliganded effect of PR has been reported in detail elsewhere <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>Synthetic progestins and glucocorticoid receptors</p>
				</st>
				<p>To ensure that the transcriptional activity observed with MPA in T47Dco cells was not occurring through an alternate steroid receptor, we evaluated the activity of the synthetic progestins on GR in the presence or absence of AR (Fig. <figr fid="F4">4</figr>). GR-positive, PR/AR-negative HeLa cells were transfected with or without AR and treated with 10 nmol/l synthetic hormones. No activity was seen with addition of ethanol or a vector alone control (data not shown). Dexamethasone, a GR agonist, exhibited equivalent robust transcriptional activity in the absence or presence of AR, suggesting that its activity is exclusively through endogenous GR. MPA also had weak GR activity (about 15% that of dexamethasone) at the 10 nmol/l dose. However, addition of AR increased the activity of MPA to levels equivalent to those of DHT. No androgenic activity was seen with R5020 or dexamethasone. Similar results would be expected with progesterone, which has about 3% relative binding affinity to AR <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. T47D-Y cells, the parental cells of the YA, YB, and Y-AR breast cancer cells, were found to contain little GR mRNA based on microarray data and exhibited no transcriptional activity when treated with dexamethasone (data not shown), allowing us to conclude that the activity of MPA in breast cancer cells occurs through PR and AR and not through GR. This study confirms the slight glucocorticoid but strong androgenic activity of MPA.</p>
				<fig id="F4">
					<title>
						<p>Figure 4</p>
					</title>
					<caption>
						<p>Glucocorticoid and androgenic activity of the synthetic progestins and Dexamethasone</p>
					</caption>
					<text>
						<p>Glucocorticoid and androgenic activity of the synthetic progestins and Dexamethasone. HeLa cells (GR<sup>+</sup>, PR<sup>-</sup>, AR<sup>-</sup>) were transfected with or without an AR expression vector, PRE<sub>2</sub>/luciferase construct and Renilla control, and treated for 20 hours with 10 nmol/l MPA, R5020, DHT, or dexamethasone. Relative luciferase activity was measured. Stippled bars are GR<sup>+ </sup>cells lacking AR; grey bars are GR<sup>+ </sup>and AR<sup>+ </sup>cells. AR, androgen receptor; DEX, dexamethasone; DHT, dihydrotestosterone; GR, glucocorticoid receptor; MPA, medroxyprogesterone acetate; PR, progesterone receptor; RLU, relative luciferase units.</p>
					</text>
					<graphic file="bcr1340-4" hint_layout="single"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Synthetic progestins and androgen receptors</p>
				</st>
				<p>The array data (Fig. <figr fid="F3">3</figr>) showed that MPA and progesterone have similar activity through PR, but clinically the two hormones exhibit different primary and side-effect profiles <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. We therefore next assessed the activity of MPA on AR (Fig. <figr fid="F5">5a</figr>). HeLa and T47D-Y cells were transfected with an AR expression vector and PRE<sub>2</sub>/luciferase (a consensus binding site for PR, AR, and GR <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>) and were treated with increasing concentrations of R5020, MPA, and DHT. Figure <figr fid="F5">5a</figr> shows that, at lower doses, MPA and DHT had approximately equivalent transcriptional activity on AR in both cell lines, and that at pharmacologic doses MPA had exceptionally strong androgenic activity in HeLa cells. R5020 had no androgenic activity in either cell line at all doses.</p>
				<fig id="F5">
					<title>
						<p>Figure 5</p>
					</title>
					<caption>
						<p>Transcriptional activities of MPA, R5020, and DHT under AR control</p>
					</caption>
					<text>
						<p>Transcriptional activities of MPA, R5020, and DHT under AR control. <b>(a) </b>Cells transiently expressing AR and PRE<sub>2</sub>/luciferase. AR-negative HeLa and T47D-Y cells were transiently transfected with an AR expression vector. Cells were cotransfected with PRE<sub>2</sub>/luciferase construct and Renilla control, treated with varying concentrations of MPA, R5020, or DHT for 20 hours, and luciferase activity was quantified. Data are reported as a percentage of 1 &#956;mol/l DHT (which was set at 100%). *<it>P </it>&lt; 0.05, 1 &#956;mol/l dose of hormone versus 1 &#956;mol/l DHT. <b>(b) </b>Androgenic activity on two different promoter constructs. HeLa cells were transiently cotransfected with and AR expression vector and either PRE<sub>2</sub>/luciferase or MMTV/luciferase. Cells were treated with ethanol, or 10 nmol/l and 1 &#956;mol/l R5020, MPA, or DHT for 20 hours, and relative luciferase activity was measured. AR, androgen receptor; DHT, dihydrotestosterone; MPA, medroxyprogesterone acetate; PR, progesterone receptor; RLU, relative luciferase units.</p>
					</text>
					<graphic file="bcr1340-5" hint_layout="double"/>
				</fig>
				<p>We then asked whether this androgenic activity of MPA was promoter dependent (Fig. <figr fid="F5">5b</figr>). HeLa cells were transfected with an AR expression vector and two different androgen responsive promoter constructs, namely PRE<sub>2</sub>/luciferase and MMTV/luciferase, and then treated with 10 nmol/l or 1 &#956;mol/l R5020, MPA, or DHT. R5020 had little or no androgenic activity at either dose on either construct. Again, on PRE<sub>2</sub>/luciferase MPA had higher AR activity than DHT, whereas on MMTV/luciferase &#8211; a more complex promoter &#8211; the AR activity of the two hormones was approximately equal.</p>
			</sec>
			<sec>
				<st>
					<p>A new, androgen receptor expressing, human breast cancer cell line</p>
				</st>
				<p>To better study the androgenic properties of synthetic progestins in breast cancer cells, we engineered T47D-Y cells to stably express wild-type AR. The new cells are called Y-AR. Figure <figr fid="F6">6a</figr> (inset) is an immunoblot showing the 110 kDa AR protein in Y-AR cells, equivalent in size to the endogenous AR of MCF-7 cells, which is shown for comparison. The subcellular localization of the stably expressed AR and their response to hormone (Fig. <figr fid="F6">6B</figr>) were analyzed by confocal microscopy. For this, AR were immunologically tagged with green fluorescent FITC and the nuclei labeled with DAPI. A secondary antibody control exhibited no nonspecific binding (not shown). In the absence of DHT, AR were predominantly cytoplasmic. Upon addition of DHT, AR moved to the nucleus within 2 hours and then upregulated by 20 hours. This behavior is similar to that of wild-type AR <abbrgrp><abbr bid="B48">48</abbr><abbr bid="B54">54</abbr></abbrgrp>. A western blot was performed that showed that AR levels in Y-AR cells are about the same as in LNCaP cells and similar to PR levels in T47D cells (data not shown).</p>
				<fig id="F6">
					<title>
						<p>Figure 6</p>
					</title>
					<caption>
						<p>Characterization Y-AR: a new breast cancer cell line stably expressing AR</p>
					</caption>
					<text>
						<p>Characterization Y-AR: a new breast cancer cell line stably expressing AR. <b>(a) </b>AR levels and function of Y-AR. Inset: whole cell extracts of Y-AR and MCF-7 cells were subjected to SDS-PAGE, and proteins were transferred to nitrocellulose and probed with the anti-AR antibody PG-21 (Upstate Biotechnology). The 110 kDa AR band is shown. Main figure: Y-AR and control T47D-Y cells were transiently transfected PRE<sub>2</sub>/luciferase and treated with DHT, MPA, and R5020 at concentrations from 0.01 to 1000 nmol/l for 20 hours. Luciferase activity is shown as a percentage of 1 mmol/l DHT (which was set at 100%). Data shown are the mean of triplicate determinations &#177; standard error. <b>(b) </b>AR immunocytochemistry in Y-AR cells. Y-AR breast cancer cells were treated with ethanol or 1 &#956;mol/l DHT for 30 min, or 2 and 20 hours. ARs were immunologically visualized using green fluorescent FITC (row A), and the cell nucleus was labeled with blue DAPI (row B). Cells were visualized using confocal microscopy and photographed at 100&#215;, as described in the Materials and method section. <b>(c) </b>PCR of the PSA transcript. RNA was harvested from Y-AR cells treated 6 and 12 hrs with ethanol, or 1 &#956;mol/l R5020, MPA, or DHT. RT-PCR was performed using PSA-specific primers. GAPDH is shown as a control. Representative results are shown. AR, androgen receptor; DHT, dihydrotestosterone; EtOH, ethanol; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MPA, medroxyprogesterone acetate; PR, progesterone receptor; PSA, prostate-specific antigen.</p>
					</text>
					<graphic file="bcr1340-6" hint_layout="double"/>
				</fig>
				<p>Functional properties of the stably expressed AR when bound by different ligands were tested in two ways: on the exogenous PRE<sub>2</sub>/luciferase reporter (Fig. <figr fid="F6">6a</figr>) and by regulation of the endogenous prostate-specific antigen transcript (Fig. <figr fid="F6">6C</figr>). Luciferase expression was measured in Y-AR cells treated with increasing concentrations of DHT, MPA, and R5020 (Fig. <figr fid="F6">6a</figr>). Both DHT and MPA generated equivalent maximum transcription levels, with the left shift by DHT suggesting that it has somewhat higher affinity for AR than does MPA. R5020 was completely inactive. No transcription was observed in the parental T47D-Y cells, which lack PR and functional AR.</p>
				<p>Prostate-specific antigen is a marker of androgenic activity not only in prostate but also in breast <abbrgrp><abbr bid="B50">50</abbr><abbr bid="B55">55</abbr><abbr bid="B56">56</abbr></abbrgrp>. Using RT-PCR, we assessed the ability of AR in Y-AR cells to regulate endogenous expression of this gene (Fig. <figr fid="F6">6c</figr>). Cells were treated for 6 or 12 hours with ethanol or hormones. Clearly, R5020 was unable to regulate prostate-specific antigen transcript expression, but both DHT and MPA were able to do so. Interestingly, MPA is reproducibly a strong regulator of this important androgen marker gene.</p>
			</sec>
			<sec>
				<st>
					<p>Expression profiling of medroxyprogesterone acetate versus dihydrotestosterone in androgen receptor-positive breast cancer cells</p>
				</st>
				<p>To understand the androgenic effects of physiologic and high-dose MPA, compared with those of physiologic DHT, Y-AR cells were treated with ethanol, 10 nmol/l progesterone, MPA or DHT, or 1 &#956;mol/l MPA for 6 hours. Gene expression profiles were assessed in triplicate, time-separated experiments, and transcripts regulated at least 2.0-fold in a statistically significant manner through AR were scored (Fig. <figr fid="F7">7a</figr>). Most genes were upregulated. The high dose of MPA was not remarkably different from the low dose, with 165 genes (about 70%) regulated in common, indicating that the 10 nmol/l dose is saturating the AR. Progesterone regulated few genes through AR (not shown) in these PR-negative cells. A comparison of equal doses (10 nmol/l) of MPA and DHT revealed that 143 genes were regulated by both hormones, representing about 60% of all DHT-regulated genes. Thus, MPA is an excellent androgen. Additionally, MPA upregulated a small subset of genes that are not DHT regulated. Similarly, DHT regulated a small subset of genes that are not regulated by MPA. Figure <figr fid="F7">7a</figr> also shows the downregulated genes, which represent less than 17% of total AR regulated genes.</p>
				<fig id="F7">
					<title>
						<p>Figure 7</p>
					</title>
					<caption>
						<p>Expression profile of AR regulated genes</p>
					</caption>
					<text>
						<p>Expression profile of AR regulated genes. Shown are expression profiles of AR-regulated genes, with physiologic DHT versus physiologic and pharmacologic MPA concentrations in Y-AR cells compared. <b>(a) </b>Venn diagram comparing the number of genes regulated at least 2.0-fold by low-dose DHT versus low and high dose MPA. Y-AR cells were treated with ethanol, or 10 nmol/l progesterone, MPA, or DHT, or 1 &#956;mol/l MPA for 6 hours in triplicate, time separated experiments. RNA was extracted, derivatized, and used to probe Affymetrix U-133 2 plus gene chips interrogating about 47,000 genes. Data were analyzed using Gene Spring software, and statistical analysis was performed using a one-way analysis of variance, with <it>P </it>&lt; 0.05 considered statistically significant for genes regulated at least 2.0-fold. <b>(b) </b>Confirmation of the hormonal regulation of four genes identified in panel a. Four genes shown to be hormone regulated in Y-AR cells (i.e. F3, Maf-B, Krt4 and p57) were chosen for further analysis. Bar graphs: the hormonal regulation of the four selected transcripts in Y-AR cells, as assessed by microarray profiling. RT-PCR: Y-AR cells were treated for 6 hours with ethanol, 10 nmol/l progesterone, MPA, or DHT, or 1 &#956;mol/l MPA and RNA was isolated. Primers directed against the transcripts of the four selected genes were used in RT-PCR reactions, and GAPDH was run as an internal control. <b>(c) </b>Venn diagrams showing number and overlap of genes regulated by 10 nmol/l MPA in AR<sup>+ </sup>Y-AR cells versus PR<sup>+ </sup>T47D cells. Microarray and data analysis were performed as described for Fig. 3a (PR<sup>+</sup>, AR<sup>- </sup>cells) and panel a above (AR<sup>+</sup>, PR<sup>- </sup>cells), and data for low-dose MPA in the two cell lines were compared. The 88 genes regulated by MPA through either PR or AR were tabulated (Additional files <supplr sid="S1">1</supplr> and <supplr sid="S2">2</supplr>). The top ranking genes are shown in Table 1. AR, androgen receptor; DHT, dihydrotestosterone; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MPA, medroxyprogesterone acetate; PR, progesterone receptor.</p>
					</text>
					<graphic file="bcr1340-7" hint_layout="double"/>
				</fig>
				<p>The regulation patterns of four genes were confirmed by RT-PCR (Fig. <figr fid="F7">7b</figr>). Three genes upregulated by both DHT and MPA, namely tissue factor (F3), MAF-B and KRT4, are shown in Fig. <figr fid="F7">7b</figr>. One gene regulated only by DHT &#8211; the cyclin dependent kinase inhibitor P57 &#8211; is also shown. No regulation of these genes was seen in the parental Y cells, which lack functional AR and PR.</p>
				<p>Figure <figr fid="F7">7c</figr> summarizes the progestational versus the androgenic properties of physiological MPA concentrations. Of 566 genes defined as MPA upregulated, about 64% were regulated through PR in T47Dco cells, about 21% through AR in Y-AR cells, and about 15% (88 genes) in both cell lines through both AR and PR. Slightly fewer genes (498) were downregulated by MPA, the striking differences being the much higher percentage of genes downregulated through PR (98%) than through AR (3%). Thus, although MPA upregulated and downregulated many genes via PR, the vast majority of genes regulated by MPA via AR were upregulated only. This is a unique finding and may reflect the ability of MPA-bound AR to recruit coactivators preferentially; this requires independent verification. The upregulated genes were narrowed to 55 genes with regulation that was independently confirmed (i.e. MPA regulated genes that were also regulated by progesterone through PR, and by DHT through AR). Table <tblr tid="T2">2</tblr> shows the top 33 of these dual regulated genes, arranged by their fold regulation through MPA compared with the relevant natural hormone in each cell line. Note that for each receptor there is remarkable similarity in the fold regulation observed using MPA compared with the natural hormone. Thus, with regard to the AR-regulated genes, MPA is as good an androgen as is DHT. Also of interest is the fact that, for these dual PR/AR-regulated genes, in some cases the PR but in others the AR were more effective. Explanations for this will require detailed analyses of the promoters in question. The complete table is given in <supplr sid="S2">Additional file 2</supplr>.</p>
				<tbl id="T2" hint_layout="double">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>Top 33 dual regulated genes</p>
					</caption>
					<tblbdy cols="6">
						<r>
							<c ca="left">
								<p>GenBank ID</p>
							</c>
							<c cspan="2" ca="center">
								<p>AR</p>
							</c>
							<c cspan="2" ca="center">
								<p>PR</p>
							</c>
							<c ca="left">
								<p>Description</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c cspan="4">
								<hr/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>MPA</p>
							</c>
							<c ca="left">
								<p>DHT</p>
							</c>
							<c ca="left">
								<p>MPA</p>
							</c>
							<c ca="left">
								<p>P</p>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c cspan="6">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_005627">NM_005627</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>67.53</p>
							</c>
							<c ca="left">
								<p>51.80</p>
							</c>
							<c ca="left">
								<p>23.33</p>
							</c>
							<c ca="left">
								<p>29.48</p>
							</c>
							<c ca="left">
								<p>Serum/glucocorticoid regulated kinase</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AI985987">AI985987</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>31.45</p>
							</c>
							<c ca="left">
								<p>33.87</p>
							</c>
							<c ca="left">
								<p>6.39</p>
							</c>
							<c ca="left">
								<p>11.72</p>
							</c>
							<c ca="left">
								<p>Sodium channel, nonvoltage-gated 1, gamma</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AI492388">AI492388</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>26.17</p>
							</c>
							<c ca="left">
								<p>11.44</p>
							</c>
							<c ca="left">
								<p>37.57</p>
							</c>
							<c ca="left">
								<p>31.08</p>
							</c>
							<c ca="left">
								<p>ti27d10.x1 NCI_CGAP_Kid11 Homo sapiens cDNA clone IMAGE:2131699 3', mRNA sequence.</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AV707102">AV707102</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>11.91</p>
							</c>
							<c ca="left">
								<p>11.13</p>
							</c>
							<c ca="left">
								<p>4.23</p>
							</c>
							<c ca="left">
								<p>4.04</p>
							</c>
							<c ca="left">
								<p>Pyruvate dehydrogenase kinase, isoenzyme 4</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_004117">NM_004117</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>11.10</p>
							</c>
							<c ca="left">
								<p>9.08</p>
							</c>
							<c ca="left">
								<p>3.15</p>
							</c>
							<c ca="left">
								<p>3.21</p>
							</c>
							<c ca="left">
								<p>FK506 binding protein 5</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AL556438">AL556438</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>10.88</p>
							</c>
							<c ca="left">
								<p>11.23</p>
							</c>
							<c ca="left">
								<p>4.77</p>
							</c>
							<c ca="left">
								<p>3.14</p>
							</c>
							<c ca="left">
								<p>TCDD-inducible poly(ADP-ribose) polymerase</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AA404269">AA404269</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>8.33</p>
							</c>
							<c ca="left">
								<p>7.36</p>
							</c>
							<c ca="left">
								<p>6.22</p>
							</c>
							<c ca="left">
								<p>5.29</p>
							</c>
							<c ca="left">
								<p>Prickle-like 1 (<it>Drosophila</it>)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AB018580">AB018580</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>7.54</p>
							</c>
							<c ca="left">
								<p>5.38</p>
							</c>
							<c ca="left">
								<p>4.74</p>
							</c>
							<c ca="left">
								<p>4.69</p>
							</c>
							<c ca="left">
								<p>Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_005461">NM_005461</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>6.82</p>
							</c>
							<c ca="left">
								<p>11.65</p>
							</c>
							<c ca="left">
								<p>15.98</p>
							</c>
							<c ca="left">
								<p>15.80</p>
							</c>
							<c ca="left">
								<p>v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_001993">NM_001993</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>6.76</p>
							</c>
							<c ca="left">
								<p>6.39</p>
							</c>
							<c ca="left">
								<p>20.32</p>
							</c>
							<c ca="left">
								<p>12.77</p>
							</c>
							<c ca="left">
								<p>Coagulation factor III (thromboplastin, tissue factor)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_001992">NM_001992</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>6.01</p>
							</c>
							<c ca="left">
								<p>5.99</p>
							</c>
							<c ca="left">
								<p>4.61</p>
							</c>
							<c ca="left">
								<p>2.84</p>
							</c>
							<c ca="left">
								<p>Coagulation factor II (thrombin) receptor</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="BE219979">BE219979</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>5.82</p>
							</c>
							<c ca="left">
								<p>8.07</p>
							</c>
							<c ca="left">
								<p>12.62</p>
							</c>
							<c ca="left">
								<p>12.49</p>
							</c>
							<c ca="left">
								<p>Interleukin 20 receptor, alpha</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_019018">NM_019018</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>5.06</p>
							</c>
							<c ca="left">
								<p>4.63</p>
							</c>
							<c ca="left">
								<p>8.18</p>
							</c>
							<c ca="left">
								<p>8.43</p>
							</c>
							<c ca="left">
								<p>Hypothetical protein FLJ11127</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_006096">NM_006096</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>4.63</p>
							</c>
							<c ca="left">
								<p>4.34</p>
							</c>
							<c ca="left">
								<p>10.19</p>
							</c>
							<c ca="left">
								<p>10.50</p>
							</c>
							<c ca="left">
								<p>N-myc downstream regulated gene 1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_012429">NM_012429</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>4.42</p>
							</c>
							<c ca="left">
								<p>4.95</p>
							</c>
							<c ca="left">
								<p>4.06</p>
							</c>
							<c ca="left">
								<p>3.76</p>
							</c>
							<c ca="left">
								<p>SEC14-like 2 (S. cerevisiae)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="W86302">W86302</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>4.22</p>
							</c>
							<c ca="left">
								<p>3.96</p>
							</c>
							<c ca="left">
								<p>2.58</p>
							</c>
							<c ca="left">
								<p>2.68</p>
							</c>
							<c ca="left">
								<p>FK506 binding protein 5</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AF288571">AF288571</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>4.07</p>
							</c>
							<c ca="left">
								<p>3.95</p>
							</c>
							<c ca="left">
								<p>2.91</p>
							</c>
							<c ca="left">
								<p>3.38</p>
							</c>
							<c ca="left">
								<p>Lymphoid enhancer-binding factor 1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AW135013">AW135013</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>4.00</p>
							</c>
							<c ca="left">
								<p>8.54</p>
							</c>
							<c ca="left">
								<p>16.37</p>
							</c>
							<c ca="left">
								<p>13.28</p>
							</c>
							<c ca="left">
								<p>v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="BF593382">BF593382</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.71</p>
							</c>
							<c ca="left">
								<p>3.53</p>
							</c>
							<c ca="left">
								<p>2.16</p>
							</c>
							<c ca="left">
								<p>2.27</p>
							</c>
							<c ca="left">
								<p>Protein kinase, AMP-activated, beta 2 non-catalytic subunit</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AF131840">AF131840</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.61</p>
							</c>
							<c ca="left">
								<p>4.13</p>
							</c>
							<c ca="left">
								<p>3.87</p>
							</c>
							<c ca="left">
								<p>3.14</p>
							</c>
							<c ca="left">
								<p>SPRY domain-containing SOCS box protein SSB-1</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AA721025">AA721025</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.47</p>
							</c>
							<c ca="left">
								<p>3.00</p>
							</c>
							<c ca="left">
								<p>5.59</p>
							</c>
							<c ca="left">
								<p>3.30</p>
							</c>
							<c ca="left">
								<p><it>Homo sapiens </it>transcribed sequence with moderate similarity to protein ref:NP_060265.1 (H.sapiens)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AI753747">AI753747</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.32</p>
							</c>
							<c ca="left">
								<p>3.23</p>
							</c>
							<c ca="left">
								<p>2.46</p>
							</c>
							<c ca="left">
								<p>2.22</p>
							</c>
							<c ca="left">
								<p>FK506 binding protein 5</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="N73742">N73742</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.31</p>
							</c>
							<c ca="left">
								<p>3.18</p>
							</c>
							<c ca="left">
								<p>3.73</p>
							</c>
							<c ca="left">
								<p>3.45</p>
							</c>
							<c ca="left">
								<p><it>Homo sapiens </it>cDNA FLJ42287 fis, clone TLIVE2005866</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AA037766">AA037766</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.27</p>
							</c>
							<c ca="left">
								<p>2.81</p>
							</c>
							<c ca="left">
								<p>3.17</p>
							</c>
							<c ca="left">
								<p>2.56</p>
							</c>
							<c ca="left">
								<p><it>Homo sapiens </it>LOC374963 (LOC374963), mRNA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AL357503">AL357503</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.17</p>
							</c>
							<c ca="left">
								<p>4.55</p>
							</c>
							<c ca="left">
								<p>8.33</p>
							</c>
							<c ca="left">
								<p>8.02</p>
							</c>
							<c ca="left">
								<p>Match: proteins: Tr:Q9UJ12 Tr:O43723 Tr:Q9VZN3</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="NM_004235">NM_004235</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.06</p>
							</c>
							<c ca="left">
								<p>4.89</p>
							</c>
							<c ca="left">
								<p>4.69</p>
							</c>
							<c ca="left">
								<p>4.83</p>
							</c>
							<c ca="left">
								<p>Kruppel-like factor 4 (gut)</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="BI668074">BI668074</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>3.06</p>
							</c>
							<c ca="left">
								<p>4.81</p>
							</c>
							<c ca="left">
								<p>2.52</p>
							</c>
							<c ca="left">
								<p>2.36</p>
							</c>
							<c ca="left">
								<p>603295907F1 NIH_MGC_96 Homo sapiens cDNA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="AL562398">AL562398</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>2.82</p>
							</c>
							<c ca="left">
								<p>2.24</p>
							</c>
							<c ca="left">
								<p>2.12</p>
							</c>
							<c ca="left">
								<p>2.14</p>
							</c>
							<c ca="left">
								<p>AL562398 Homo sapiens NEUROBLASTOMA COT 25-NORMALIZED</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="BG150485">BG150485</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>2.78</p>
							</c>
							<c ca="left">
								<p>2.88</p>
							</c>
							<c ca="left">
								<p>2.79</p>
							</c>
							<c ca="left">
								<p>2.03</p>
							</c>
							<c ca="left">
								<p>Solute carrier family 6 (neurotransmitter transporter, taurine), member 6</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="BF056282">BF056282</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>2.77</p>
							</c>
							<c ca="left">
								<p>2.43</p>
							</c>
							<c ca="left">
								<p>2.33</p>
							</c>
							<c ca="left">
								<p>2.18</p>
							</c>
							<c ca="left">
								<p>Chromosome 9 open reading frame 52</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ext-link ext-link-type="gen" ext-link-id="BF514079">BF514079</ext-link>
								</p>
							</c>
							<c ca="left">
								<p>2.73</p>
							</c>
							<c ca="left">
								<p>4.33</p>
							</c>
							<c ca="left">
								<p>8.09</p>
							</c>
							<c ca="left">
								<p>7.66</p>
							</c>
							<c ca="left">
								<p>Kruppel-like factor 4 (gut)</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Shown are the top genes and their fold upregulation in Y-AR (AR<sup>+</sup>) and T47D (PR<sup>+</sup>) cells treated with physiologic concentrations of MPA and either DHT or progesterone. AR, androgen receptors; DHT, dihydrotestosterone; MPA, medroxyprogesterone acetate; P, progesterone; PR, progesterone receptor.</p>
					</tblfn>
				</tbl>
				<suppl id="S2">
					<title>
						<p>Additional File 2</p>
					</title>
					<text>
						<p>Excel files containing tables showing the genes regulated by DHT and MPA in Y-AR breast cancer cells: A, DHT upregulated; B, MPA 1 &#956;mol/l upregulated; C, MPA 10 nmol/l upregulated; D, DHT downregulated; E, 1 MPA &#956;mol/l downregulated; F, MPA 10 nmol/l downregulated; G, upregulated through AR and PR.</p>
					</text>
					<file name="bcr1340-S2.zip">
						<p>Click here for file</p>
					</file>
				</suppl>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Discussion</p>
			</st>
			<sec>
				<st>
					<p>Synthetic progestins, medroxygprogesterone acetate, and progesterone receptor</p>
				</st>
				<p>Synthetic progestins were developed for use in oral contraception and HRT. As a result they were tested for efficacy compared with progesterone, using animal models and physiologic end-points such as inhibition of ovulation and decidualization of the endometrium, focused on the reproductive tract <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Consequently, progestins in current clinical use tend to resemble progesterone on the endometrium, with differences, if any, reflecting variations in bioavailability, potency, and metabolism <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. However, progestins also target organs other than the reproductive tract, including brain, breast, immune, and gastrointestinal systems <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. This is often reflected in differences in their side-effect profile. For example, compared with progesterone, MPA decreases seizure threshold <abbrgrp><abbr bid="B58">58</abbr></abbrgrp> and incidence of sickle cell crises <abbrgrp><abbr bid="B59">59</abbr></abbrgrp>, whereas its androgenic effects may lead to weight gain and lipid profile alterations <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. Whether these side effects are mediated by PR or other receptors is unclear. The mammary gland was rarely the subject of screening in the initial stages of pharmaceutical progestin development. Nevertheless, it too is a critical target.</p>
				<p>The impression that progesterone is an etiologic agent for development of breast cancer is based in part on the increased proliferative activity observed in normal breast during the luteal phase of the menstrual cycle associated with rising progesterone levels <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>. Whether synthetic progestins for HRT can similarly increase breast cancer risk has been evaluated in several studies <abbrgrp><abbr bid="B62">62</abbr><abbr bid="B63">63</abbr></abbrgrp>, including the recent Women's Health Initiative <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B6">6</abbr></abbrgrp>. They show that, in comparison with estrogens alone (including conjugated equine estrogens), synthetic progestins such as MPA increase breast cancer risk <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B6">6</abbr></abbrgrp>. The present study used breast cancer models to profile the progestational and androgenic properties of MPA, with the goal of elucidating its gene regulatory properties. We define 'progestational' effects as those that resemble progesterone and are mediated by PR, and 'androgenic' effects as those that resemble DHT and are mediated by AR. Note that this is an arbitrary definition. For example, in transient transcription assays we observed that DHT can signal through PR-B (Fig. <figr fid="F2">2d,e</figr>), an observation that requires further study. If this is indeed the case, then one could argue that this effect of DHT through PR is also 'androgenic'.</p>
				<p>The results of our transcriptional assays suggest varying transcriptional effects of hormone in different tissues and with expression of one or both isoforms of PR. The relevance of PR isoform expression in breast cancer has only recently been appreciated <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B64">64</abbr></abbrgrp>. Although the present study utilized breast cancer cells that coexpress PR, as is the case in normal breast and in the majority of breast cancers, studies in breast cancer cells expressing only one PR isoform are in progress. We hypothesize that the increase in luciferase activity in cervical cancer compared with breast cancer cells may reflect varying levels of coactivators/corepressors in each tissue, as was demonstrated by Liu and coworkers <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>. In addition, the increased transcriptional activity in wild-type PR-A and PR-B containing cells compared with cells containing only one receptor may reflect the additional contribution of the PR-A/PR-B dimer to transcription.</p>
				<p>Here we addressed the global gene regulatory properties of MPA in comparison with those of progesterone in wild-type cells that express equimolar levels of PR-A and PR-B. We found that approximately equal numbers of genes are downregulated and upregulated by each progestin. Because previous studies <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp> assessing the contributions of individual PR isoforms reported more upregulated genes, the present finding may represent the contribution of the PR heterodimer to gene regulation. We found that almost all transcripts regulated by progesterone were also regulated by MPA, and in most cases that regulatory levels were approximately equal, with some transcript levels altered more extensively by MPA than by progesterone. Although a few genes appeared to be uniquely MPA regulated, their regulation was weak and the significance of this, if any, requires further study. PR-negative T47D-Y cells were tested as a negative control. Very few genes (about 25) were regulated by the progestins in these cells, and we speculate that this may represent actions of alternate steroid receptors such as GR or perhaps membrane-bound PR <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. Overall, we conclude that with regard to PR, MPA may be a somewhat more potent but otherwise qualitatively similar progestin to progesterone. Its clinical value lies in its resistance to metabolism and more stable pharmacokinetics as compared with progesterone <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. In studies to be reported elsewhere, we found similarly that several other synthetic progestins in clinical use have expression profiles resembling progesterone <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>Androgenicity of medroxyprogesterone acetate</p>
				</st>
				<p>In addition, our studies clearly indicate that, unlike progesterone, MPA is a potent androgen in breast cancer cells. In Y-AR cells treated with 0.1 nmol/l DHT or MPA, we also found that the androgenic activity of both hormones is 80&#8211;90% inhibitable by the antiandrogen bicalutamide (10 &#956;mol/l; data not shown). That MPA has androgenic activity has been suspected based on its side-effect profile in other organs <abbrgrp><abbr bid="B67">67</abbr></abbrgrp> at the low concentrations used for oral contraception and HRT. With regard to normal breast, epithelial cells express estrogen receptor (ER), PR and AR, but adjacent myoepithelial cells and stroma express none of the three steroid receptors <abbrgrp><abbr bid="B68">68</abbr></abbrgrp>. In malignancy, grade 1 and 2 ductal carcinoma <it>in situ </it>express ER, PR and AR, whereas the majority of grade 3 ductal carcinoma <it>in situ </it>are ER and PR negative but continue to be AR-positive <abbrgrp><abbr bid="B68">68</abbr></abbrgrp>. Lea and coworkers <abbrgrp><abbr bid="B69">69</abbr></abbrgrp> quantitated AR by immunohistochemistry in 1026 metastatic tumors and found that AR were present at double the frequency of PR. In fact, in one out of four tumors AR are expressed as the sole sex hormone receptor. The expression of AR in ER-negative tumors is associated with a better disease-free survival <abbrgrp><abbr bid="B70">70</abbr></abbrgrp>. In this regard, it is interesting that addition of testosterone to standard estrogen or estrogen + progesterone therapy reportedly reduces the risk associated with HRT to that of the untreated population <abbrgrp><abbr bid="B71">71</abbr></abbrgrp>. Thus, the expression and activation of AR may play an important role in the development of breast cancers and response to hormone therapies.</p>
				<p>The data presented here show that, in human breast cancer cells, physiologic doses of MPA elicit as good an androgenic response as DHT and as good a progestational response as progesterone. We would conclude that at the physiologic doses used for oral contraception and HRT, MPA delivers a powerful androgenic outcome. However, MPA is often given at pharmacologic doses, such as when it is used as a second-line agent for the treatment of metastatic breast cancer and for treatment of early endometrial cancer <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. Numerous investigators have suggested that the efficacy of MPA at pharmacologic doses in breast cancer treatment is due to activation of AR rather than PR at those doses <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. Based on our data (Fig. <figr fid="F7">7a</figr>), we would argue that high-dose MPA is no different from low dose MPA. This makes sense if physiologic concentrations suffice to saturate both PR and AR, in which case higher concentrations would not be expected to have further effects. Indeed, our data clearly show that increasing the dose of MPA does not alter its transcriptional profile. Based on this we would argue that there is no rationale for using high-dose MPA for any indication, and suggest that lower doses might suffice for treatment of endometrial and breast cancers. If lower doses are indeed sufficient, then the administration of high doses may only exacerbate side effects without improving the therapeutic index. Further studies evaluating the use of lower doses of MPA in treatment of AR-positive breast cancers would be of interest.</p>
				<p>There was some overlap (Fig. <figr fid="F7">7c</figr>) among genes upregulated by MPA <it>in vivo </it>through both PR and AR. As we define them, these are 55 genes upregulated by progesterone through PR, and by DHT through AR, with MPA having the ability to activate both sets. We suggest that this blurs the boundaries between androgenic and progestational effects. Further analysis of the promoter sequences and tissue distributions of these 55 genes may suggest a pattern of regulation that allows selective activation by only one receptor <it>in vivo</it>. Alternatively, these may be key genes that evolved in both males and females, for regulation by androgens or progesterone, respectively. In summary, more genes are regulated (both up and down) by MPA through PR than through AR. Interestingly, there are genes regulated by DHT that are not regulated by MPA (Fig. <figr fid="F7">7a</figr>). The mechanisms underlying this differential effect also require study. One of these genes is p57, a cyclin-dependent kinase inhibitor with activity that suggests a possible mechanism for inhibition of cell cycle regulation and proliferation by AR in breast cancers.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st>
			<p>The finding that physiologic MPA is both a potent progestin and androgen in the same cell type has important implications for women's health. The strong androgenic effects of MPA when compared with progesterone suggest that physiologic hormone replacement using progestins such as MPA in HRT do not mimic the actions of endogenous progesterone alone. Our data suggest that the findings of the Women's Health Initiative may represent the dual action of MPA on PR and AR. The studies described here are limited to short term treatments <it>in vitro</it>, with the limitations thereof. We have begun to investigate the effects of long-term MPA treatment using the new Y-AR breast cancer cells growing as xenografts in nude mice to test further our hypothesis that the activity of MPA in the breast is mediated through its dual function as a progestin and androgen.</p>
		</sec>
		<sec>
			<st>
				<p>Abbreviations</p>
			</st>
			<p>AR = androgen receptors; DCC = dextran-coated charcoal; DHT = dihydrotestosterone; ER = estrogen receptor; GR = glucocorticoid receptors; HRT = hormone replacement therapy; MPA = medroxyprogesterone acetate; PBS = phosphate-buffered saline; PR = progesterone receptor; PRE = progesterone responsive element; RT-PCR = reverse transcription polymerase chain reaction; RR = relative risk.</p>
		</sec>
		<sec>
			<st>
				<p>Competing interests</p>
			</st>
			<p>The author(s) declare that they have no competing interests.</p>
		</sec>
		<sec>
			<st>
				<p>Authors' contributions</p>
			</st>
			<p>RPG designed the studies, created the Y-AR breast cancer cell line, and analyzed the microarray data. BMJ participated in the coordination of the studies, performed the microarray experiments and helped in the analysis of the data. SS performed the tissue culture and assisted in the microarray experiments. KBH conceived the study, participated in its design and coordination, and helped to draft the manuscript.</p>
		</sec>
	</bdy>
	<bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st>
				<p>Dr Ghatge was supported in part by the Colorado WRHR Career Development Fund (HD001274-05), Department of Obstetrics and Gynecology, and the Academic Enrichment Fund. Research support was provided by the NIH (CA26869), the National Foundation for Cancer Research, the Avon Foundation, and Family Health International. We thank Dr E Wilson for the AR plasmid, Purevsuren Jambal for technical assistance, Ted Shade for preliminary data analysis, and the University of Colorado Cancer Center's Tissue Culture, Gene Expression, and Light Microscopy Core Facilities. This work will be submitted, in partial requirement of the PhD Thesis, to the Molecular Biology Program.</p>
			</sec>
		</ack>
		<refgrp>
			<bibl id="B1">
				<title>
					<p>Trends in contraceptive use in the United States: 1982&#8211;1995</p>
				</title>
				<aug>
					<au>
						<snm>Piccinino</snm>
						<fnm>LJ</fnm>
					</au>
					<au>
						<snm>Mosher</snm>
						<fnm>WD</fnm>
					</au>
				</aug>
				<source>Fam Plann Perspect</source>
				<pubdate>1998</pubdate>
				<volume>30</volume>
				<fpage>4</fpage>
				<lpage>10</lpage>
				<note>46</note>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">9494809</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B2">
				<title>
					<p>Estrogen plus progestin and the incidence of dementia and mild cognitive impairment in postmenopausal women: the Women's Health Initiative Memory Study: a randomized controlled trial</p>
				</title>
				<aug>
					<au>
						<snm>Shumaker</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Legault</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Rapp</snm>
						<fnm>SR</fnm>
					</au>
					<au>
						<snm>Thal</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Wallace</snm>
						<fnm>RB</fnm>
					</au>
					<au>
						<snm>Ockene</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Hendrix</snm>
						<fnm>SL</fnm>
					</au>
					<au>
						<snm>Jones</snm>
						<fnm>BN</fnm>
						<suf>3rd</suf>
					</au>
					<au>
						<snm>Assaf</snm>
						<fnm>AR</fnm>
					</au>
					<au>
						<snm>Jackson</snm>
						<fnm>RD</fnm>
					</au>
					<etal/>
				</aug>
				<source>JAMA</source>
				<pubdate>2003</pubdate>
				<volume>289</volume>
				<fpage>2651</fpage>
				<lpage>2662</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1001/jama.289.20.2651</pubid>
						<pubid idtype="pmpid" link="fulltext">12771112</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results From the Women's Health Initiative randomized controlled trial</p>
				</title>
				<aug>
					<au>
						<snm>Rossouw</snm>
						<fnm>JE</fnm>
					</au>
					<au>
						<snm>Anderson</snm>
						<fnm>GL</fnm>
					</au>
					<au>
						<snm>Prentice</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>LaCroix</snm>
						<fnm>AZ</fnm>
					</au>
					<au>
						<snm>Kooperberg</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Stefanick</snm>
						<fnm>ML</fnm>
					</au>
					<au>
						<snm>Jackson</snm>
						<fnm>RD</fnm>
					</au>
					<au>
						<snm>Beresford</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Howard</snm>
						<fnm>BV</fnm>
					</au>
					<au>
						<snm>Johnson</snm>
						<fnm>KC</fnm>
					</au>
					<au>
						<cnm>Writing Group for the Women's Health Initiative Investigators</cnm>
					</au>
					<etal/>
				</aug>
				<source>JAMA</source>
				<pubdate>2002</pubdate>
				<volume>288</volume>
				<fpage>321</fpage>
				<lpage>333</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1001/jama.288.3.321</pubid>
						<pubid idtype="pmpid" link="fulltext">12117397</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B4">
				<title>
					<p>Effects of conjugated equine estrogen in postmenopausal women with hysterectomy: the Women's Health Initiative randomized controlled trial</p>
				</title>
				<aug>
					<au>
						<snm>Anderson</snm>
						<fnm>GL</fnm>
					</au>
					<au>
						<snm>Limacher</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Assaf</snm>
						<fnm>AR</fnm>
					</au>
					<au>
						<snm>Bassford</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Beresford</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Black</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Bonds</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Brunner</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Brzyski</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Caan</snm>
						<fnm>B</fnm>
					</au>
					<etal/>
				</aug>
				<source>JAMA</source>
				<pubdate>2004</pubdate>
				<volume>291</volume>
				<fpage>1701</fpage>
				<lpage>1712</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1001/jama.291.14.1701</pubid>
						<pubid idtype="pmpid" link="fulltext">15082697</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>Menopausal estrogen and estrogen-progestin replacement therapy and breast cancer risk</p>
				</title>
				<aug>
					<au>
						<snm>Schairer</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Lubin</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Troisi</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Sturgeon</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Brinton</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Hoover</snm>
						<fnm>R</fnm>
					</au>
				</aug>
				<source>JAMA</source>
				<pubdate>2000</pubdate>
				<volume>283</volume>
				<fpage>485</fpage>
				<lpage>491</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1001/jama.283.4.485</pubid>
						<pubid idtype="pmpid" link="fulltext">10659874</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>Effects of Conjugated Equine Estrogen in Postmenopausal Women with Hysterectomy: the Women's Health Initiative randomized controlled trial</p>
				</title>
				<aug>
					<au>
						<snm>Anderson</snm>
						<fnm>GL</fnm>
					</au>
					<au>
						<snm>Limacher</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Assaf</snm>
						<fnm>AR</fnm>
					</au>
					<au>
						<snm>Bassford</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Beresford</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Black</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Bonds</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Brunner</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Brzyski</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Caan</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<cnm>Women's Health Initiative Steerin Committee</cnm>
					</au>
					<etal/>
				</aug>
				<source>JAMA</source>
				<pubdate>2004</pubdate>
				<volume>291</volume>
				<fpage>1701</fpage>
				<lpage>1712</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1001/jama.291.14.1701</pubid>
						<pubid idtype="pmpid" link="fulltext">15082697</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B7">
				<aug>
					<au>
						<snm>Speroff</snm>
						<fnm>L</fnm>
					</au>
				</aug>
				<source>A Clinical Guide for Contraception</source>
				<publisher>Williams &amp; Wilkins; Baltimore, MD</publisher>
				<edition>2</edition>
				<pubdate>1996</pubdate>
			</bibl>
			<bibl id="B8">
				<title>
					<p>New human breast cancer cells to study progesterone receptor isoform ratio effects and ligand-independent gene regulation</p>
				</title>
				<aug>
					<au>
						<snm>Jacobsen</snm>
						<fnm>BM</fnm>
					</au>
					<au>
						<snm>Richer</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Schittone</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2002</pubdate>
				<volume>277</volume>
				<fpage>27793</fpage>
				<lpage>27800</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M202584200</pubid>
						<pubid idtype="pmpid" link="fulltext">12021276</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p>Differential gene regulation by the two progesterone receptor isoforms in human breast cancer cells</p>
				</title>
				<aug>
					<au>
						<snm>Richer</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Jacobsen</snm>
						<fnm>BM</fnm>
					</au>
					<au>
						<snm>Manning</snm>
						<fnm>NG</fnm>
					</au>
					<au>
						<snm>Abel</snm>
						<fnm>MG</fnm>
					</au>
					<au>
						<snm>Wolf</snm>
						<fnm>DM</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2001</pubdate>
				<volume>277</volume>
				<fpage>5209</fpage>
				<lpage>5218</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M110090200</pubid>
						<pubid idtype="pmpid" link="fulltext">11717311</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B10">
				<title>
					<p>Divergent impact of progesterone and medroxyprogesterone acetate (Provera) on nuclear mitogen-activated protein kinase signaling</p>
				</title>
				<aug>
					<au>
						<snm>Nilsen</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Brinton</snm>
						<fnm>RD</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>2003</pubdate>
				<volume>100</volume>
				<fpage>10506</fpage>
				<lpage>10511</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">193591</pubid>
						<pubid idtype="pmpid" link="fulltext">12925744</pubid>
						<pubid idtype="doi">10.1073/pnas.1334098100</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B11">
				<title>
					<p>Progesterone, but not medroxyprogesterone, inhibits vascular cell adhesion molecule-1 expression in human vascular endothelial cells</p>
				</title>
				<aug>
					<au>
						<snm>Otsuki</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Saito</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Xu</snm>
						<fnm>X</fnm>
					</au>
					<au>
						<snm>Sumitani</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Kouhara</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Kishimoto</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Kasayama</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>Arterioscler Thromb Vasc Biol</source>
				<pubdate>2001</pubdate>
				<volume>21</volume>
				<fpage>243</fpage>
				<lpage>248</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">11156860</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B12">
				<title>
					<p>Fluorescent cellular sensors of steroid receptor ligands</p>
				</title>
				<aug>
					<au>
						<snm>Muddana</snm>
						<fnm>SS</fnm>
					</au>
					<au>
						<snm>Peterson</snm>
						<fnm>BR</fnm>
					</au>
				</aug>
				<source>Chembiochem</source>
				<pubdate>2003</pubdate>
				<volume>4</volume>
				<fpage>848</fpage>
				<lpage>855</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/cbic.200300606</pubid>
						<pubid idtype="pmpid" link="fulltext">12964159</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>Pharmacological profile of progestins</p>
				</title>
				<aug>
					<au>
						<snm>Sitruk-Ware</snm>
						<fnm>R</fnm>
					</au>
				</aug>
				<source>Maturitas</source>
				<pubdate>2004</pubdate>
				<volume>47</volume>
				<fpage>277</fpage>
				<lpage>283</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.maturitas.2004.01.001</pubid>
						<pubid idtype="pmpid" link="fulltext">15063480</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B14">
				<title>
					<p>Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B</p>
				</title>
				<aug>
					<au>
						<snm>Kastner</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Krust</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Turcotte</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Stropp</snm>
						<fnm>U</fnm>
					</au>
					<au>
						<snm>Tora</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Gronemeyer</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Chambon</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>EMBO J</source>
				<pubdate>1990</pubdate>
				<volume>9</volume>
				<fpage>1603</fpage>
				<lpage>1614</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">551856</pubid>
						<pubid idtype="pmpid">2328727</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B15">
				<title>
					<p>An N-terminal inhibitory function, IF, suppresses transcription by the A-isoform but not the B-isoform of human progesterone receptors</p>
				</title>
				<aug>
					<au>
						<snm>Hovland</snm>
						<fnm>AR</fnm>
					</au>
					<au>
						<snm>Powell</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Takimoto</snm>
						<fnm>GS</fnm>
					</au>
					<au>
						<snm>Tung</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1998</pubdate>
				<volume>273</volume>
				<fpage>5455</fpage>
				<lpage>5460</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.273.10.5455</pubid>
						<pubid idtype="pmpid" link="fulltext">9488667</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B16">
				<title>
					<p>A limiting factor mediates the differential activation of promoters by the human progesterone receptor isoforms</p>
				</title>
				<aug>
					<au>
						<snm>Meyer</snm>
						<fnm>M-E</fnm>
					</au>
					<au>
						<snm>Quirin-Stricker</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Lerouge</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Bocquel</snm>
						<fnm>M-T</fnm>
					</au>
					<au>
						<snm>Gronemeyer</snm>
						<fnm>H</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1992</pubdate>
				<volume>267</volume>
				<fpage>10882</fpage>
				<lpage>10887</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">1587864</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B17">
				<title>
					<p>A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B isoform</p>
				</title>
				<aug>
					<au>
						<snm>Sartorius</snm>
						<fnm>CA</fnm>
					</au>
					<au>
						<snm>Melville</snm>
						<fnm>MY</fnm>
					</au>
					<au>
						<snm>Hovland</snm>
						<fnm>AR</fnm>
					</au>
					<au>
						<snm>Tung</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Takimoto</snm>
						<fnm>GS</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>Mol Endocrinol</source>
				<pubdate>1994</pubdate>
				<volume>8</volume>
				<fpage>1347</fpage>
				<lpage>1360</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/me.8.10.1347</pubid>
						<pubid idtype="pmpid">7854352</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B18">
				<title>
					<p>Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function</p>
				</title>
				<aug>
					<au>
						<snm>Vegeto</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Shabaz</snm>
						<fnm>MM</fnm>
					</au>
					<au>
						<snm>Wen</snm>
						<fnm>DX</fnm>
					</au>
					<au>
						<snm>Goldman</snm>
						<fnm>ME</fnm>
					</au>
					<au>
						<snm>O'Malley</snm>
						<fnm>BW</fnm>
					</au>
					<au>
						<snm>McDonnell</snm>
						<fnm>DP</fnm>
					</au>
				</aug>
				<source>Mol Endocrinol</source>
				<pubdate>1993</pubdate>
				<volume>7</volume>
				<fpage>1244</fpage>
				<lpage>1255</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/me.7.10.1244</pubid>
						<pubid idtype="pmpid">8264658</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors</p>
				</title>
				<aug>
					<au>
						<snm>Tung</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Mohamed</snm>
						<fnm>MK</fnm>
					</au>
					<au>
						<snm>Hoeffler</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>Takimoto</snm>
						<fnm>GS</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>Mol Endocrinol</source>
				<pubdate>1993</pubdate>
				<volume>7</volume>
				<fpage>1256</fpage>
				<lpage>1265</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/me.7.10.1256</pubid>
						<pubid idtype="pmpid">8123133</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B20">
				<title>
					<p>Antagonist-occupied human progesterone receptors bound to DNA are functionally switched to transcriptional agonists by cAMP</p>
				</title>
				<aug>
					<au>
						<snm>Sartorius</snm>
						<fnm>CA</fnm>
					</au>
					<au>
						<snm>Tung</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Takimoto</snm>
						<fnm>GS</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1993</pubdate>
				<volume>268</volume>
				<fpage>9262</fpage>
				<lpage>9266</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">8387487</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B21">
				<title>
					<p>Heterogeneity of progesterone receptors A and B expression in human endometrial glands and stroma</p>
				</title>
				<aug>
					<au>
						<snm>Mote</snm>
						<fnm>PA</fnm>
					</au>
					<au>
						<snm>Balleine</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>McGowan</snm>
						<fnm>EM</fnm>
					</au>
					<au>
						<snm>Clarke</snm>
						<fnm>CL</fnm>
					</au>
				</aug>
				<source>Hum Reprod</source>
				<pubdate>2000</pubdate>
				<fpage>48</fpage>
				<lpage>56</lpage>
				<xrefbib>
					<pubid idtype="pmpid">11041221</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B22">
				<title>
					<p>Nonfunctioning progesterone receptors in the developed oviducts from estrogen-withdrawn immature chicks and in aged nonlaying hens</p>
				</title>
				<aug>
					<au>
						<snm>Boyd-Leinen</snm>
						<fnm>PA</fnm>
					</au>
					<au>
						<snm>Fournier</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Spelsberg</snm>
						<fnm>TC</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>1982</pubdate>
				<volume>111</volume>
				<fpage>30</fpage>
				<lpage>36</lpage>
				<xrefbib>
					<pubid idtype="pmpid">7084117</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B23">
				<title>
					<p>Circannual rhythms in steroid receptor concentration and nuclear binding in the chick oviduct</p>
				</title>
				<aug>
					<au>
						<snm>Spelsberg</snm>
						<fnm>TC</fnm>
					</au>
					<au>
						<snm>Halberg</snm>
						<fnm>F</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>1980</pubdate>
				<volume>107</volume>
				<fpage>1234</fpage>
				<lpage>1244</lpage>
				<xrefbib>
					<pubid idtype="pmpid">7408770</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B24">
				<title>
					<p>The ontogeny of gene expression of progestin receptors in the female rat brain</p>
				</title>
				<aug>
					<au>
						<snm>Kato</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Hirata</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Nozawa</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Mouri</snm>
						<fnm>N</fnm>
					</au>
				</aug>
				<source>J Steroid Biochem Mol Biol</source>
				<pubdate>1993</pubdate>
				<volume>47</volume>
				<fpage>173</fpage>
				<lpage>182</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0960-0760(93)90072-5</pubid>
						<pubid idtype="pmpid">8274433</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B25">
				<title>
					<p>Characterization of progesterone receptor A and B expression in human breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Graham</snm>
						<fnm>JD</fnm>
					</au>
					<au>
						<snm>Yeates</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Balleine</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Harvey</snm>
						<fnm>SS</fnm>
					</au>
					<au>
						<snm>Milliken</snm>
						<fnm>JS</fnm>
					</au>
					<au>
						<snm>Bilous</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Clarke</snm>
						<fnm>CL</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1995</pubdate>
				<volume>55</volume>
				<fpage>5063</fpage>
				<lpage>5068</lpage>
				<xrefbib>
					<pubid idtype="pmpid">7585552</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B26">
				<title>
					<p>Breast cancer patients with progesterone receptor PR-A-Rich tumors have poorer disease-free survival rates</p>
				</title>
				<aug>
					<au>
						<snm>Hopp</snm>
						<fnm>TA</fnm>
					</au>
					<au>
						<snm>Weiss</snm>
						<fnm>HL</fnm>
					</au>
					<au>
						<snm>Hilsenbeck</snm>
						<fnm>SG</fnm>
					</au>
					<au>
						<snm>Cui</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Allred</snm>
						<fnm>DC</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
					<au>
						<snm>Fuqua</snm>
						<fnm>SA</fnm>
					</au>
				</aug>
				<source>Clin Cancer Res</source>
				<pubdate>2004</pubdate>
				<volume>10</volume>
				<fpage>2751</fpage>
				<lpage>2760</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1158/1078-0432.CCR-03-0141</pubid>
						<pubid idtype="pmpid" link="fulltext">15102680</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B27">
				<title>
					<p>Molecular mechanisms of action of steroid/thyroid receptor superfamily members</p>
				</title>
				<aug>
					<au>
						<snm>Tsai</snm>
						<fnm>M-J</fnm>
					</au>
					<au>
						<snm>O'Malley</snm>
						<fnm>BW</fnm>
					</au>
				</aug>
				<source>Ann Rev Biochem</source>
				<pubdate>1994</pubdate>
				<volume>63</volume>
				<fpage>451</fpage>
				<lpage>486</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1146/annurev.bi.63.070194.002315</pubid>
						<pubid idtype="pmpid" link="fulltext">7979245</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B28">
				<title>
					<p>Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor</p>
				</title>
				<aug>
					<au>
						<snm>Arriza</snm>
						<fnm>JL</fnm>
					</au>
					<au>
						<snm>Weinberger</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Cerelli</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Glaser</snm>
						<fnm>TM</fnm>
					</au>
					<au>
						<snm>Handelin</snm>
						<fnm>BL</fnm>
					</au>
					<au>
						<snm>Housman</snm>
						<fnm>DE</fnm>
					</au>
					<au>
						<snm>Evans</snm>
						<fnm>RM</fnm>
					</au>
				</aug>
				<source>Science</source>
				<pubdate>1987</pubdate>
				<volume>237</volume>
				<fpage>268</fpage>
				<lpage>275</lpage>
				<xrefbib>
					<pubid idtype="pmpid">3037703</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B29">
				<title>
					<p>Characterization of response elements for androgens, glucocorticoids and progestins in mouse mammary tumour virus</p>
				</title>
				<aug>
					<au>
						<snm>Ham</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Thomson</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Needham</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Webb</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Parker</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Nucleic Acids Res</source>
				<pubdate>1988</pubdate>
				<volume>16</volume>
				<fpage>5263</fpage>
				<lpage>5276</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">336766</pubid>
						<pubid idtype="pmpid">2838812</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B30">
				<title>
					<p>A DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression</p>
				</title>
				<aug>
					<au>
						<snm>Strahle</snm>
						<fnm>U</fnm>
					</au>
					<au>
						<snm>Klock</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Schutz</snm>
						<fnm>G</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1987</pubdate>
				<volume>84</volume>
				<fpage>7871</fpage>
				<lpage>7875</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">299431</pubid>
						<pubid idtype="pmpid" link="fulltext">2891134</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B31">
				<title>
					<p>Molecular biology of the androgen receptor</p>
				</title>
				<aug>
					<au>
						<snm>Gelmann</snm>
						<fnm>EP</fnm>
					</au>
				</aug>
				<source>J Clin Oncol</source>
				<pubdate>2002</pubdate>
				<volume>20</volume>
				<fpage>3001</fpage>
				<lpage>3015</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1200/JCO.2002.10.018</pubid>
						<pubid idtype="pmpid" link="fulltext">12089231</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B32">
				<aug>
					<au>
						<snm>Goodman</snm>
						<fnm>LS</fnm>
					</au>
					<au>
						<snm>Hardman</snm>
						<fnm>JG</fnm>
					</au>
					<au>
						<snm>Limbird</snm>
						<fnm>LE</fnm>
					</au>
					<au>
						<snm>Gilman</snm>
						<fnm>AG</fnm>
					</au>
				</aug>
				<source>Goodman &amp; Gilman's The Pharmacological Basis of Therapeutics</source>
				<publisher>New York: McGraw-Hill</publisher>
				<edition>10</edition>
				<pubdate>2001</pubdate>
			</bibl>
			<bibl id="B33">
				<title>
					<p>Progesterone receptor regulation in T47D human breast cancer cells: analysis by density labeling of progesterone receptor synthesis and degradation and their modulation by progestin</p>
				</title>
				<aug>
					<au>
						<snm>Nardulli</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Katzenellenbogen</snm>
						<fnm>BS</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>1988</pubdate>
				<volume>122</volume>
				<fpage>1532</fpage>
				<lpage>1540</lpage>
				<xrefbib>
					<pubid idtype="pmpid">3345726</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B34">
				<title>
					<p>Progesterone metabolism in T47Dco human breast cancer cells &#8211; II. Intracellular metabolic path of progesterone and synthetic progestins</p>
				</title>
				<aug>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
					<au>
						<snm>Pike</snm>
						<fnm>AW</fnm>
					</au>
					<au>
						<snm>Gonzalez-Aller</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Fennessey</snm>
						<fnm>PV</fnm>
					</au>
				</aug>
				<source>J Steroid Biochem</source>
				<pubdate>1986</pubdate>
				<volume>25</volume>
				<fpage>911</fpage>
				<lpage>916</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0022-4731(86)90323-7</pubid>
						<pubid idtype="pmpid">3467141</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B35">
				<title>
					<p>Progesterone receptor replenishment in T47D human breast cancer cells. Roles of protein synthesis and hormone metabolism</p>
				</title>
				<aug>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
					<au>
						<snm>Mockus</snm>
						<fnm>MB</fnm>
					</au>
					<au>
						<snm>Pike</snm>
						<fnm>AW</fnm>
					</au>
					<au>
						<snm>Fennessey</snm>
						<fnm>PV</fnm>
					</au>
					<au>
						<snm>Sheridan</snm>
						<fnm>RL</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1983</pubdate>
				<volume>258</volume>
				<fpage>7603</fpage>
				<lpage>7610</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">6683273</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B36">
				<title>
					<p>Medroxyprogesterone acetate in human serum</p>
				</title>
				<aug>
					<au>
						<snm>Mathrubutham</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Fotherby</snm>
						<fnm>K</fnm>
					</au>
				</aug>
				<source>J Steroid Biochem</source>
				<pubdate>1981</pubdate>
				<volume>14</volume>
				<fpage>783</fpage>
				<lpage>786</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0022-4731(81)90015-7</pubid>
						<pubid idtype="pmpid">6457936</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B37">
				<title>
					<p>Medroxyprogesterone acetate therapy in advanced breast cancer: the predictive value of androgen receptor expression</p>
				</title>
				<aug>
					<au>
						<snm>Birrell</snm>
						<fnm>SN</fnm>
					</au>
					<au>
						<snm>Roder</snm>
						<fnm>DM</fnm>
					</au>
					<au>
						<snm>Horsfall</snm>
						<fnm>DJ</fnm>
					</au>
					<au>
						<snm>Bentel</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Tilley</snm>
						<fnm>WD</fnm>
					</au>
				</aug>
				<source>J Clin Oncol</source>
				<pubdate>1995</pubdate>
				<volume>13</volume>
				<fpage>1572</fpage>
				<lpage>1577</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">7602345</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B38">
				<title>
					<p>Adjuvant high-dose medroxyprogesterone acetate for early breast cancer: 13 years update in a multicentre randomized trial</p>
				</title>
				<aug>
					<au>
						<snm>Focan</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Beauduin</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Salamon</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>de Greve</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>de Wasch</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Lobelle</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>Majois</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Tagnon</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Tytgat</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>van Belle</snm>
						<fnm>S</fnm>
					</au>
					<etal/>
				</aug>
				<source>Br J Cancer</source>
				<pubdate>2001</pubdate>
				<volume>85</volume>
				<fpage>1</fpage>
				<lpage>8</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1054/bjoc.2001.1829</pubid>
						<pubid idtype="pmpid" link="fulltext">11437394</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B39">
				<title>
					<p>Oral medroxyprogesterone acetate in the treatment of advanced or recurrent endometrial carcinoma: a dose-response study by the Gynecologic Oncology Group</p>
				</title>
				<aug>
					<au>
						<snm>Thigpen</snm>
						<fnm>JT</fnm>
					</au>
					<au>
						<snm>Brady</snm>
						<fnm>MF</fnm>
					</au>
					<au>
						<snm>Alvarez</snm>
						<fnm>RD</fnm>
					</au>
					<au>
						<snm>Adelson</snm>
						<fnm>MD</fnm>
					</au>
					<au>
						<snm>Homesley</snm>
						<fnm>HD</fnm>
					</au>
					<au>
						<snm>Manetta</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Soper</snm>
						<fnm>JT</fnm>
					</au>
					<au>
						<snm>Given</snm>
						<fnm>FT</fnm>
					</au>
				</aug>
				<source>J Clin Oncol</source>
				<pubdate>1999</pubdate>
				<volume>17</volume>
				<fpage>1736</fpage>
				<lpage>1744</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">10561210</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B40">
				<title>
					<p>Multiple actions of synthetic 'progestins' on the growth of ZR-75-1 human breast cancer cells: an in vitro model for the simultaneous assay of androgen, progestin, estrogen, and glucocorticoid agonistic and antagonistic activities of steroids</p>
				</title>
				<aug>
					<au>
						<snm>Poulin</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Baker</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Poirier</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Labrie</snm>
						<fnm>F</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res Treat</source>
				<pubdate>1991</pubdate>
				<volume>17</volume>
				<fpage>197</fpage>
				<lpage>210</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/BF01806369</pubid>
						<pubid idtype="pmpid">1645605</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B41">
				<title>
					<p>Estrogen, androgen, glucocorticoid, and progesterone receptors in progestin-induced regression of human breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Teulings</snm>
						<fnm>FA</fnm>
					</au>
					<au>
						<snm>van Gilse</snm>
						<fnm>HA</fnm>
					</au>
					<au>
						<snm>Henkelman</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Portengen</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Alexieva-Figusch</snm>
						<fnm>J</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1980</pubdate>
				<volume>40</volume>
				<fpage>2557</fpage>
				<lpage>2561</lpage>
				<xrefbib>
					<pubid idtype="pmpid">6248208</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B42">
				<title>
					<p>Androgens inhibit basal and estrogen-induced cell proliferation in the ZR-75-1 human breast cancer cell line</p>
				</title>
				<aug>
					<au>
						<snm>Poulin</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Baker</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Labrie</snm>
						<fnm>F</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res Treat</source>
				<pubdate>1988</pubdate>
				<volume>12</volume>
				<fpage>213</fpage>
				<lpage>225</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/BF01805942</pubid>
						<pubid idtype="pmpid">3242650</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B43">
				<title>
					<p>Androgen and glucocorticoid receptor-mediated inhibition of cell proliferation by medroxyprogesterone acetate in ZR-75-1 human breast cancer cells</p>
				</title>
				<aug>
					<au>
						<snm>Poulin</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Baker</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Poirier</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Labrie</snm>
						<fnm>F</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res Treat</source>
				<pubdate>1989</pubdate>
				<volume>13</volume>
				<fpage>161</fpage>
				<lpage>172</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/BF01806528</pubid>
						<pubid idtype="pmpid">2525057</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B44">
				<title>
					<p>New progestogens: a review of their effects in perimenopausal and postmenopausal women</p>
				</title>
				<aug>
					<au>
						<snm>Sitruk-Ware</snm>
						<fnm>R</fnm>
					</au>
				</aug>
				<source>Drugs Aging</source>
				<pubdate>2004</pubdate>
				<volume>21</volume>
				<fpage>865</fpage>
				<lpage>883</lpage>
				<xrefbib>
					<pubid idtype="pmpid">15493951</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B45">
				<title>
					<p>New T47D breast cancer cell lines for the independent study of progesterone B- and A-receptors: only antiprogestin-occupied B-receptors are switched to transcriptional agonists by cAMP</p>
				</title>
				<aug>
					<au>
						<snm>Sartorius</snm>
						<fnm>CA</fnm>
					</au>
					<au>
						<snm>Groshong</snm>
						<fnm>SD</fnm>
					</au>
					<au>
						<snm>Miller</snm>
						<fnm>LA</fnm>
					</au>
					<au>
						<snm>Powell</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Tung</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Takimoto</snm>
						<fnm>GS</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1994</pubdate>
				<volume>54</volume>
				<fpage>3668</fpage>
				<lpage>3877</lpage>
				<xrefbib>
					<pubid idtype="pmpid">8033081</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B46">
				<title>
					<p>Variant T47D human breast cancer cells with high progesterone-receptor levels despite estrogen and antiestrogen resistance</p>
				</title>
				<aug>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
					<au>
						<snm>Mockus</snm>
						<fnm>MB</fnm>
					</au>
					<au>
						<snm>Lessey</snm>
						<fnm>BA</fnm>
					</au>
				</aug>
				<source>Cell</source>
				<pubdate>1982</pubdate>
				<volume>28</volume>
				<fpage>633</fpage>
				<lpage>642</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/0092-8674(82)90218-5</pubid>
						<pubid idtype="pmpid">7200400</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B47">
				<title>
					<p>Convergence of progesterone with growth factor and cytokine signaling in breast cancer. Progesterone receptors regulate signal transducers and activators of transcription expression and activity</p>
				</title>
				<aug>
					<au>
						<snm>Richer</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Lange</snm>
						<fnm>CA</fnm>
					</au>
					<au>
						<snm>Manning</snm>
						<fnm>NG</fnm>
					</au>
					<au>
						<snm>Owen</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Powell</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1998</pubdate>
				<volume>273</volume>
				<fpage>31317</fpage>
				<lpage>31326</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.273.47.31317</pubid>
						<pubid idtype="pmpid" link="fulltext">9813040</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B48">
				<title>
					<p>Transcriptional activation and nuclear targeting signals of the human androgen receptor</p>
				</title>
				<aug>
					<au>
						<snm>Simental</snm>
						<fnm>JA</fnm>
					</au>
					<au>
						<snm>Sar</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Lane</snm>
						<fnm>MV</fnm>
					</au>
					<au>
						<snm>French</snm>
						<fnm>FS</fnm>
					</au>
					<au>
						<snm>Wilson</snm>
						<fnm>EM</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1991</pubdate>
				<volume>266</volume>
				<fpage>510</fpage>
				<lpage>518</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">1985913</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B49">
				<title>
					<p>Mapping the unique activation function 3 in the progesterone B-receptor upstream segment. Two LXXLL motifs and a tryptophan residue are required for activity</p>
				</title>
				<aug>
					<au>
						<snm>Tung</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Shen</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Abel</snm>
						<fnm>MG</fnm>
					</au>
					<au>
						<snm>Powell</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Takimoto</snm>
						<fnm>GS</fnm>
					</au>
					<au>
						<snm>Sartorius</snm>
						<fnm>CA</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2001</pubdate>
				<volume>276</volume>
				<fpage>39843</fpage>
				<lpage>39851</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M106843200</pubid>
						<pubid idtype="pmpid" link="fulltext">11546784</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B50">
				<title>
					<p>Cluster analysis and display of genome-wide expression patterns</p>
				</title>
				<aug>
					<au>
						<snm>Eisen</snm>
						<fnm>MB</fnm>
					</au>
					<au>
						<snm>Spellman</snm>
						<fnm>PT</fnm>
					</au>
					<au>
						<snm>Brown</snm>
						<fnm>PO</fnm>
					</au>
					<au>
						<snm>Botstein</snm>
						<fnm>D</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1998</pubdate>
				<volume>95</volume>
				<fpage>14863</fpage>
				<lpage>14868</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">24541</pubid>
						<pubid idtype="pmpid" link="fulltext">9843981</pubid>
						<pubid idtype="doi">10.1073/pnas.95.25.14863</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B51">
				<title>
					<p>Cloning and expression of a novel, truncated, progesterone receptor</p>
				</title>
				<aug>
					<au>
						<snm>Saner</snm>
						<fnm>KJ</fnm>
					</au>
					<au>
						<snm>Welter</snm>
						<fnm>BH</fnm>
					</au>
					<au>
						<snm>Zhang</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Hansen</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Dupont</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Wei</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Price</snm>
						<fnm>TM</fnm>
					</au>
				</aug>
				<source>Mol Cell Endocrinol</source>
				<pubdate>2003</pubdate>
				<volume>200</volume>
				<fpage>155</fpage>
				<lpage>163</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0303-7207(02)00380-5</pubid>
						<pubid idtype="pmpid" link="fulltext">12644308</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B52">
				<title>
					<p>Progesterone-independent effects of human progesterone receptors (PRs) in estrogen receptor-positive breast cancer: PR isoform-specific gene regulation and tumor biology</p>
				</title>
				<aug>
					<au>
						<snm>Jacobsen</snm>
						<fnm>BM</fnm>
					</au>
					<au>
						<snm>Schittone</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Richer</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Horwitz</snm>
						<fnm>KB</fnm>
					</au>
				</aug>
				<source>Mol Endocrinol</source>
				<pubdate>2005</pubdate>
				<volume>19</volume>
				<fpage>574</fpage>
				<lpage>587</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/me.2004-0287</pubid>
						<pubid idtype="pmpid" link="fulltext">15563544</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B53">
				<title>
					<p>Drospirenone: pharmacology and pharmacokinetics of a unique progestogen</p>
				</title>
				<aug>
					<au>
						<snm>Krattenmacher</snm>
						<fnm>R</fnm>
					</au>
				</aug>
				<source>Contraception</source>
				<pubdate>2000</pubdate>
				<volume>62</volume>
				<fpage>29</fpage>
				<lpage>38</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0010-7824(00)00133-5</pubid>
						<pubid idtype="pmpid" link="fulltext">11024226</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B54">
				<title>
					<p>Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones</p>
				</title>
				<aug>
					<au>
						<snm>Kemppainen</snm>
						<fnm>JA</fnm>
					</au>
					<au>
						<snm>Lane</snm>
						<fnm>MV</fnm>
					</au>
					<au>
						<snm>Sar</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Wilson</snm>
						<fnm>EM</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1992</pubdate>
				<volume>267</volume>
				<fpage>968</fpage>
				<lpage>974</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">1730684</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B55">
				<title>
					<p>Steroid hormonal regulation of growth, prostate specific antigen secretion, and transcription mediated by the mutated androgen receptor in CWR22Rv1 human prostate carcinoma cells</p>
				</title>
				<aug>
					<au>
						<snm>Attardi</snm>
						<fnm>BJ</fnm>
					</au>
					<au>
						<snm>Burgenson</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Hild</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Reel</snm>
						<fnm>JR</fnm>
					</au>
				</aug>
				<source>Mol Cell Endocrinol</source>
				<pubdate>2004</pubdate>
				<volume>222</volume>
				<fpage>121</fpage>
				<lpage>132</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.mce.2004.04.013</pubid>
						<pubid idtype="pmpid" link="fulltext">15249132</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B56">
				<title>
					<p>Characterization of androgen receptor and nuclear receptor co-regulator expression in human breast cancer cell lines exhibiting differential regulation of kallikreins 2 and 3</p>
				</title>
				<aug>
					<au>
						<snm>Magklara</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Brown</snm>
						<fnm>TJ</fnm>
					</au>
					<au>
						<snm>Diamandis</snm>
						<fnm>EP</fnm>
					</au>
				</aug>
				<source>Int J Cancer</source>
				<pubdate>2002</pubdate>
				<volume>100</volume>
				<fpage>507</fpage>
				<lpage>514</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/ijc.10520</pubid>
						<pubid idtype="pmpid" link="fulltext">12124798</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B57">
				<title>
					<p>Physiological action of progesterone in target tissues</p>
				</title>
				<aug>
					<au>
						<snm>Graham</snm>
						<fnm>JD</fnm>
					</au>
					<au>
						<snm>Clarke</snm>
						<fnm>CL</fnm>
					</au>
				</aug>
				<source>Endocr Rev</source>
				<pubdate>1997</pubdate>
				<volume>18</volume>
				<fpage>502</fpage>
				<lpage>519</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/er.18.4.502</pubid>
						<pubid idtype="pmpid" link="fulltext">9267762</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B58">
				<title>
					<p>Treatment of seizures with medroxyprogesterone acetate: preliminary report</p>
				</title>
				<aug>
					<au>
						<snm>Mattson</snm>
						<fnm>RH</fnm>
					</au>
					<au>
						<snm>Cramer</snm>
						<fnm>JA</fnm>
					</au>
					<au>
						<snm>Caldwell</snm>
						<fnm>BV</fnm>
					</au>
					<au>
						<snm>Siconolfi</snm>
						<fnm>BC</fnm>
					</au>
				</aug>
				<source>Neurology</source>
				<pubdate>1984</pubdate>
				<volume>34</volume>
				<fpage>1255</fpage>
				<lpage>1258</lpage>
				<xrefbib>
					<pubid idtype="pmpid">6540415</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B59">
				<title>
					<p>Medroxyprogesterone acetate and homozygous sickle-cell disease</p>
				</title>
				<aug>
					<au>
						<snm>De Ceulaer</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Gruber</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Hayes</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Serjeant</snm>
						<fnm>GR</fnm>
					</au>
				</aug>
				<source>Lancet</source>
				<pubdate>1982</pubdate>
				<volume>2</volume>
				<fpage>229</fpage>
				<lpage>231</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0140-6736(82)90320-8</pubid>
						<pubid idtype="pmpid">6178915</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B60">
				<title>
					<p>Effects of estrogen or estrogen/progestin regimens on heart disease risk factors in postmenopausal women. The Postmenopausal Estrogen/Progestin Interventions (PEPI) Trial. The Writing Group for the PEPI Trial</p>
				</title>
				<aug>
					<au>
						<cnm>Anonymous</cnm>
					</au>
				</aug>
				<source>JAMA</source>
				<pubdate>1995</pubdate>
				<volume>273</volume>
				<fpage>199</fpage>
				<lpage>208</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1001/jama.273.3.199</pubid>
						<pubid idtype="pmpid">7807658</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B61">
				<title>
					<p>Proliferation of breast epithelial cells in healthy women during the menstrual cycle</p>
				</title>
				<aug>
					<au>
						<snm>Soderqvist</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Isaksson</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>von Schoultz</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Carlstrom</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Tani</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Skoog</snm>
						<fnm>L</fnm>
					</au>
				</aug>
				<source>Am J Obstet Gynecol</source>
				<pubdate>1997</pubdate>
				<volume>176</volume>
				<fpage>123</fpage>
				<lpage>128</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">9024102</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B62">
				<title>
					<p>Breast Cancer and hormone-replacement therapy in the Million Women Study</p>
				</title>
				<aug>
					<au>
						<snm>Beral</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<cnm>Million Women Study Collaborators</cnm>
					</au>
				</aug>
				<source>Lancet</source>
				<pubdate>2003</pubdate>
				<volume>362</volume>
				<fpage>419</fpage>
				<lpage>427</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0140-6736(03)14596-5</pubid>
						<pubid idtype="pmpid" link="fulltext">12927427</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B63">
				<title>
					<p>Effects of estrogen and estrogen-progestin on mammographic parenchymal density. Postmenopausal Estrogen/Progestin Interventions (PEPI) Investigators</p>
				</title>
				<aug>
					<au>
						<snm>Greendale</snm>
						<fnm>GA</fnm>
					</au>
					<au>
						<snm>Reboussin</snm>
						<fnm>BA</fnm>
					</au>
					<au>
						<snm>Sie</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Singh</snm>
						<fnm>HR</fnm>
					</au>
					<au>
						<snm>Olson</snm>
						<fnm>LK</fnm>
					</au>
					<au>
						<snm>Gatewood</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Bassett</snm>
						<fnm>LW</fnm>
					</au>
					<au>
						<snm>Wasilauskas</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Bush</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Barrett-Connor</snm>
						<fnm>E</fnm>
					</au>
				</aug>
				<source>Ann Intern Med</source>
				<pubdate>1999</pubdate>
				<volume>130</volume>
				<fpage>262</fpage>
				<lpage>269</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">10068383</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B64">
				<title>
					<p>Loss of co-ordinate expression of progesterone receptors A and B is an early event in breast carcinogenesis</p>
				</title>
				<aug>
					<au>
						<snm>Mote</snm>
						<fnm>PA</fnm>
					</au>
					<au>
						<snm>Bartow</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Tran</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Clarke</snm>
						<fnm>CL</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res Treat</source>
				<pubdate>2002</pubdate>
				<volume>72</volume>
				<fpage>163</fpage>
				<lpage>172</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1023/A:1014820500738</pubid>
						<pubid idtype="pmpid" link="fulltext">12038707</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B65">
				<title>
					<p>Coactivator/corepressor ratios modulate PR-mediated transcription by the selective receptor modulator RU486</p>
				</title>
				<aug>
					<au>
						<snm>Liu</snm>
						<fnm>Z</fnm>
					</au>
					<au>
						<snm>Auboeuf</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Wong</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Chen</snm>
						<fnm>JD</fnm>
					</au>
					<au>
						<snm>Tsai</snm>
						<fnm>SY</fnm>
					</au>
					<au>
						<snm>Tsai</snm>
						<fnm>MJ</fnm>
					</au>
					<au>
						<snm>O'Malley</snm>
						<fnm>BW</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>2002</pubdate>
				<volume>99</volume>
				<fpage>7940</fpage>
				<lpage>7944</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">122999</pubid>
						<pubid idtype="pmpid" link="fulltext">12048256</pubid>
						<pubid idtype="doi">10.1073/pnas.122225699</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B66">
				<title>
					<p>Quantitative analysis of gene regulation by seven clinically relevant progestins suggests a highly similar mechanism of action through progesterone receptors in T47D breast cancer cells</p>
				</title>
				<aug>
					<au>
						<snm>Bray</snm>
						<fnm>JD</fnm>
					</au>
					<au>
						<snm>Jelinsky</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Ghatge</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Bray</snm>
						<fnm>JA</fnm>
					</au>
					<au>
						<snm>Tunkey</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Saraf</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Jacobsen</snm>
						<fnm>BM</fnm>
					</au>
					<au>
						<snm>Richer</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Brown</snm>
						<fnm>EL</fnm>
					</au>
					<au>
						<snm>Winneker</snm>
						<fnm>RC</fnm>
					</au>
					<etal/>
				</aug>
				<source>J Steroid Biochem Mol Biol</source>
				<pubdate>2005</pubdate>
				<inpress/>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">16157482</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B67">
				<aug>
					<au>
						<cnm>American Society of Health-System Pharmacists</cnm>
					</au>
				</aug>
				<source>AHFS Drug Handbook</source>
				<publisher>Philadelphia, PA: Lippincott Williams &amp; Wilkins</publisher>
				<edition>2</edition>
				<pubdate>2003</pubdate>
			</bibl>
			<bibl id="B68">
				<title>
					<p>Androgen receptors frequently are expressed in breast carcinomas: potential relevance to new therapeutic strategies</p>
				</title>
				<aug>
					<au>
						<snm>Moinfar</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Okcu</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Tsybrovskyy</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Regitnig</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Lax</snm>
						<fnm>SF</fnm>
					</au>
					<au>
						<snm>Weybora</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Ratschek</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Tavassoli</snm>
						<fnm>FA</fnm>
					</au>
					<au>
						<snm>Denk</snm>
						<fnm>H</fnm>
					</au>
				</aug>
				<source>Cancer</source>
				<pubdate>2003</pubdate>
				<volume>98</volume>
				<fpage>703</fpage>
				<lpage>711</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/cncr.11532</pubid>
						<pubid idtype="pmpid" link="fulltext">12910513</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B69">
				<title>
					<p>Improved measurement of androgen receptors in human breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Lea</snm>
						<fnm>OA</fnm>
					</au>
					<au>
						<snm>Kvinnsland</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Thorsen</snm>
						<fnm>T</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1989</pubdate>
				<volume>49</volume>
				<fpage>7162</fpage>
				<lpage>7167</lpage>
				<xrefbib>
					<pubid idtype="pmpid">2582456</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B70">
				<title>
					<p>Androgen receptor expression in estrogen receptor-negative breast cancer. Immunohistochemical, clinical, and prognostic associations</p>
				</title>
				<aug>
					<au>
						<snm>Agoff</snm>
						<fnm>SN</fnm>
					</au>
					<au>
						<snm>Swanson</snm>
						<fnm>PE</fnm>
					</au>
					<au>
						<snm>Linden</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Hawes</snm>
						<fnm>SE</fnm>
					</au>
					<au>
						<snm>Lawton</snm>
						<fnm>TJ</fnm>
					</au>
				</aug>
				<source>Am J Clin Pathol</source>
				<pubdate>2003</pubdate>
				<volume>120</volume>
				<fpage>725</fpage>
				<lpage>731</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1309/42F0-0D0D-JD0J-5EDT</pubid>
						<pubid idtype="pmpid" link="fulltext">14608899</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B71">
				<title>
					<p>Breast cancer incidence in postmenopausal women using testosterone in addition to usual hormone therapy</p>
				</title>
				<aug>
					<au>
						<snm>Dimitrakakis</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Jones</snm>
						<fnm>RA</fnm>
					</au>
					<au>
						<snm>Liu</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Bondy</snm>
						<fnm>CA</fnm>
					</au>
				</aug>
				<source>Menopause</source>
				<pubdate>2004</pubdate>
				<volume>11</volume>
				<fpage>531</fpage>
				<lpage>535</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1097/01.GME.0000119983.48235.D3</pubid>
						<pubid idtype="pmpid" link="fulltext">15356405</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B72">
				<title>
					<p>Differential steroid hormone regulation of human glandular kallikrein (hK2) and prostate-specific antigen (PSA) in breast cancer cell lines</p>
				</title>
				<aug>
					<au>
						<snm>Magklara</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Grass</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Diamandis</snm>
						<fnm>EP</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res Treat</source>
				<pubdate>2000</pubdate>
				<volume>59</volume>
				<fpage>263</fpage>
				<lpage>270</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1023/A:1006304518750</pubid>
						<pubid idtype="pmpid" link="fulltext">10832596</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
		</refgrp>
	</bm>
</art>

